snOPY snoRNA Orthological Gene Database
Xenopus_tropicalis SNORD38
sequence
CTTCTGATGATAACCTTGTCCAGTTCTGCTACTGAAACTATGCGATGATATTTCTGAAT
CTGAAGAAG
  Box motif
  Complementary to target RNA
length 68
organism Xenopus_tropicalis
snoRNA name SNORD38
alias
chromosome ⁄ contig scaffold_261
locus ⁄ host gene rps8
organization Intronic
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved