snOPY snoRNA Orthological Gene Database

Family: SNORD38

CLUSTAL 2.0.10 multiple sequence alignment A_thaliana300170 ----------GGCAGTGATGATTAAA---ACCAGTTCTGCTTCAGATAAT A_thaliana300171 -GGGATGATGAATTGTAACAGCTTGATACGCCAGTTCTGCTTCAGATAAT A_thaliana300172 TGGGATGATGAATTGTAACAGCTTGATACGCCAGTTCTGCTTCAGATAAT C_elegans300029 --GAATCTCAGACGGGGAAAGTTAATCTTCACAATAACTCAGTAGCAGAA C_familiaris300433 ------TCTTGGTGATGAAAACT---TTGTCCAGTTCTGCTACTGACTTT C_familiaris300434 -----CTTCTTATGATGAAAACT---G--TCCAGTTCTGCTACTGAAAGG C_porcellus300936 ------TCTTAATGATGAAAACT---TTGTCCAGTTCTGCTACTGACTTC D_novemcinctus300067 -----CTTCTTGTGATGAAAACT---CTGTCCAGTTCTGCTTCTGAAGGG D_novemcinctus300257 ------ACTCAGTGATGAAAACT---TAGTCCAGTTCTGCTACTGACTGT D_novemcinctus300485 ------ACTCAGTGATGAAAACT---TTGTCCAATTTTGCTACTGACTTT D_melanogaster300151 -------TAACATGATGATGATT-----TTTCAGTTCTGCTACTGAAGAC E_telfairi300829 -----CTTCTTGTGATGAGAACT---CTGTCCAGTTCTGCTACTGAAGGG E_telfairi300830 ------TCTCAATGATGAAACCT---TTGTCCAGTTCTGCTACTGATTTG E_caballus300286 ------TCTCAGTGATGAAAACT---TTGTCCAGTTCTGCTGCTGACTTG E_caballus300287 -------CCTTGTGATGAAAA-----CTGTCCAGTTCTGCTGCTGAAGGG F_catus300272 -----CTTCTTATGATGAAAACT---GCGTCCAGTTCTGCTGCTGAAGGG G_gallus300102 -----CTTCTAATGATGATACTT---CTGTCCAGTTCTGCTACTGAAGGG G_gallus300103 -----CTTCTGGTGATGAGACCT---TTGTCCAGTTCTGCTACTGA-ATT G_aculeatus300016 ------TTTCAATGAAGATAACT---T----CAGTTCTGCTACTGAATGA G_aculeatus300017 ------TTTCAATGAAGATAACT---T----CAGTTCTGCTACTGAATGA G_aculeatus300018 ------TTTCAATGAAGATAACT---T----CAGTTCTGCTACTGAATGA G_aculeatus300132 ------TTTCTATGATGATAACT---TTGTTCAGTTCTGCTACTGATTGC H_sapiens300610 ------TGTCAGTGATGAAAATT---TTGTCTAGTTCTGCTACTGACATT H_sapiens300663 ------TTCTCGTGATGAAAACT---CTGTCCAGTTCTGCTACTGAAGGG H_sapiens300664 ------TCTCAGTGATGAAAACT---TTGTCCAGTTCTGCTACTGACAGT L_africana300338 ------TCTCAGTGATGAAAACT---TTGTCCAGTTCTGCTACTGACTTT M_mulatta300437 ------TCTCAGTGATGAAAACT---TTGTCAAGTTATGCTACTGACATT M_mulatta300484 ------TCTTAGTTATGAAAACT---TTGTCCAGTTCTGCTACTGACTTT M_mulatta300580 -------TCTCGTGATGAAACCT---CTGTCCAGTTCTGCTACTGAAGGG M_mulatta300581 ------TCTCAGTGATGAAAACT---TTGTCCAGTTCTGCTACTGACAGT M_mulatta300598 ------TCTCAGTGATGAAAATT---TTGTCCAGTTCTGCTACTGACATT M_murinus300449 -----CTTCTTATGATGAAAGCT---TAGTCCAGTTCTGCTACTGAAGGG M_murinus300450 ------TCTCAGTGATGAAAACA---TTGTCCAGTTCTGCTACTGACTTT M_domestica300074 ----TCTCCTAGTGATGAGAACC---CTGTCCAGTTCTGCTACTGAGGCT M_domestica300075 -----CTTCTGATGAGGAGAACC---TTGTCCAGTTCTGCTACTGATGTA M_musculus300108 ----------TTTTATGAAAAAT---GTG-CCAGTTCTGCTGCTGACCTC M_musculus300954 ------TCTCGGTGATGAGAACT---TTGTCCAGTTCTGCTGCTGATCTC M_musculus300955 -----CTTCTTGTGATGAAAATA---CTGTCCAGTTCTGCTACTGAAGG- O_anatinus304515 -----CTTCACGTGATGATAATA---TTGTCCAGTTCTGCTACTGAAGGG O_cuniculus300460 ------GCCTTGTGATGAGACT----CTGTCCAGTTCTGCTACTGAAGGG O_cuniculus300461 ------TCTCCGTGATGAGAACT---TTGTCCAGTTCTGCTACTGATTTG O_latipes300085 ------TTTCAGTGATGATAACT---TTGACCAGTTCTGCTACTGAATGG O_latipes300086 ------TTTCTGTGAAGATAACT---TTGTCCAGTTCTGCTACTGAATAT O_garnettii300257 ------TTATTTTGATGAAAACT---CCATCCAGTTCTGCTACTGAAGGG O_garnettii300465 -------TCTTAGGAAGAAAATT---CTGTTCATTTCTGCTAGTGAAGGG O_garnettii300688 -----CTTCTTGTGATGAAAAAAA--CTGTCCAGTTCTGCTACTGAAGGG O_garnettii300722 -------TCTCAAAAATGTCACAG--TTCCCCAGTTCTGCCACTGAAGGC P_troglodytes300277 ------TCTTAGTGATGAAAACT---TTGTCCAGTTCTGCTAATGACTTT P_troglodytes300397 ------TGTCAGTGATGAAA-CT---TTGTCAAGTTATGCTACTCACATG P_troglodytes300523 -------TCTCGTGATGAAAACT---CTGTCCAGTTCTGCTACTGAAGGG P_troglodytes300524 ------TCTCAGTGATGAAAATT---TTGTCCAGTTCTGCTACTGACAGT P_troglodytes300628 ------TGTCAGTGATGAAAATT---TTGTCTAGTTCTGCTACTGACATT P_pygmaeus300054 ------TCTCAGTGATGAAA-CT---TTGTCAAGTTATGCTACTGACATG P_pygmaeus300198 ------TCTTAGTGATGAAAACT---TTGTCCAGTTCTGCTAATGACTTT P_pygmaeus300594 ------TCTCAGTGATGAAAACT---TTGTCCAGTTCTGCTACTGACAGT P_pygmaeus300595 -------TCTCGTGATGAAAACT---CTGTCCAGTTCTGCTACTGAAGGG P_pygmaeus300719 ------TCTCAGTGATGAAAATT---TTGTCCAGTTCTGCTACTGACATT R_norvegicus300910 ------TCTCAGTGATGAGAACT---TTGTCCAGTTCTGCTGCTGACTTC R_norvegicus300911 -----CTTCTTGTGATGAAAATA---CTGTCCAGTTCTGCTACTGAAGG- S_cerevisiae300025 ---CTACAATGATGATAAAATTTA--CTATTCAGTTCTGCTTCTGAACCA S_araneus300073 ------TCTCAGTGATGAAAACT---TTGTCCAGTTCTGCTACTGACTTG S_araneus300779 ------TATCAATGATGAAAACT---TTGTCCAGTTCTGCTGTTGACTTG S_araneus301049 -----CTTCTTGTGATGATAACT---CTGTCCAGTTCTGCTACTGAAGGG S_araneus301050 ------TCTCAGTGATGAAAACT---TTGTCCAGTTCTGCTACTGACTTG S_tridecemlineatus300292 -------TCTTGTGATGAAAACT---CTGTCCAGTTCTGCTGCTGAAGGG S_tridecemlineatus300293 ------TCTCAGTGATGAAAACT---TTGTCCAGTTCTGCTACTGACTTG T_nigroviridis300143 ------TTTCAGTGATGATAACT---TTGTCCAGTTCTGCTACTGAATGA T_belangeri300369 -------TCTCGTGATGAAAACT---CTGTCCAGTTCTGCTACTGAAGGG T_belangeri300370 ------TCTCCATGATGAAAACT---TCGTCCAGTTCTGCTACTGACTTT X_tropicalis300101 --------CTTCTGATGATAACC---TTGTCCAGTTCTGCTACTGAAACT X_tropicalis300102 -----CTTCTGCTGATGATAACT---TTGTCCAGTTCTGCTACTGAAATT X_tropicalis300103 -----CTTCTGCTGATGATAACT---TTGTCCAGTTCTGCTACTGAAATT X_tropicalis300104 -----CTTCTGCTGATGATAACC---TTGTCCAGTTCTGCTACTGAGACT * * * A_thaliana300170 T----CCTGATCGAAGAAACTGTATACCAA--AAAACTTCTGAGC----- A_thaliana300171 T----CTTGATCGAAAAAGCTGTATTCTTATCCGAGCC------------ A_thaliana300172 T----CTTGATCGAAAAAGCTGTATTCTTATCCGAGCCTTTCATTGCTAT C_elegans300029 C----TGGATATCACATCACCGATTC------------------------ C_familiaris300433 A----AAGTGACGATAAAGTAT-AT-CTGAGGAGA--------------- C_familiaris300434 A----AAGAGATGAAAGCCTTTAGTGCTGAGGAAG--------------- C_porcellus300936 -----AAGTGCTGATAAAGTAT-AT-CTGACAAGA--------------- D_novemcinctus300067 A----AAGAGATGAA-GCATTTAGTGCTGAGGAAG--------------- D_novemcinctus300257 A----A-GTGACAATAAAGTATTAC-CTGAGGAGA--------------- D_novemcinctus300485 A----A-GTGATGATAAAGTATTAT-CTGAGGAGA--------------- D_melanogaster300151 AGTTGACGAAAGCAAAAATACCAAAATCACTGAAA--------------- E_telfairi300829 A----GAGAGATGA--GTCTTTAGTGCTGAGGAAG--------------- E_telfairi300830 -----ACTTGTTGATAAAGTATTGT-CTGAGGAGA--------------- E_caballus300286 -----AAGTGATGATAAAGTCT-AT-CTGAGAAGA--------------- E_caballus300287 G----GAGAGATGAAAGCCTTTAGTGCTGACGAAGG-------------- F_catus300272 A----AAGAGATGAAAGCTTTTAGTGCTGAGGAAG--------------- G_gallus300102 A----GAGCGATGACACTTGT-GATGCTGAGGAAG--------------- G_gallus300103 T----GAGGGATGACTGTTTGGAGATCTGAAGAGG--------------- G_aculeatus300016 -----AAGTGATGAAAATG-AAGAC--TGAGAAA---------------- G_aculeatus300017 -----AAGTGATGAAAATG-AAGAC--TGAGAAA---------------- G_aculeatus300018 -----AAGTGATGATAATG-AAGAC--TGAGAAA---------------- G_aculeatus300132 -----AAATGGTGATAATACGACAC-CTGAGTAAG--------------- H_sapiens300610 -----AAGTTATGATAAAGTCT-GT-CTGAGGAGA--------------- H_sapiens300663 A----GAGAGATGAGAGCCTTTTAGGCTGAGGAA---------------- H_sapiens300664 -----AAGTGAAGATAAAGTGT-GT-CTGAGGAGA--------------- L_africana300338 -----ACTTGATGATAAAGTATTAT-CTGAGGAGA--------------- M_mulatta300437 -----AAGTGATGATAAAGTGT-GT-CTGAGGAGA--------------- M_mulatta300484 A----A-GTGATGATAAACTAT-GT-CTGAGGGGA--------------- M_mulatta300580 A----GAGAGATGAGAGCCTTT-AGGCTGAGGAA---------------- M_mulatta300581 -----AAGTGACGATAAAGTGT-GT-CTGAGGAGA--------------- M_mulatta300598 -----AACTGATGATAAAGTAT-GT-CTGAGAAGA--------------- M_murinus300449 A----GAGAGATGAAAGCTTTTAATGCTGAAGAAG--------------- M_murinus300450 A----A-GTGACGATAAAGTAT-GT-CTGAGGAGA--------------- M_domestica300074 G----A-GTGACGACAGAGGTTTGT-CTGAAGAGA--------------- M_domestica300075 T----CAGAGATGACAGCTTTGTGTGCTGAAGAAG--------------- M_musculus300108 T----AAGTGAGGATGAAG-TGTAT-CTGAGGAGA--------------- M_musculus300954 TT---AAGTGAGGATGAAG-T-TAT-CTGAGGAGA--------------- M_musculus300955 A----ATGAGATGAACA-CTTTAGTGCTGAAGAAG--------------- O_anatinus304515 A----CAGCGGTGACACCCTTAGAATCTGAAGAAG--------------- O_cuniculus300460 A----GAGAGATGAAAGCCTTGAGTGCTGAGGAAGGC------------- O_cuniculus300461 G----AAGTGAGGATAAAG-TACAC-CTGAGGAGA--------------- O_latipes300085 -----AAGTGGTGATATTC-AAG-TTCTGAGAAA---------------- O_latipes300086 -----AAGAGATGA-ATTTTAACACTCTGAGAAA---------------- O_garnettii300257 A----GAGAGATGAAAGCTTTTAATGCTGAGGCAA--------------- O_garnettii300465 A----GAGAGATGAATGCTTTTAATGCTGAAGA----------------- O_garnettii300688 A----GAGAGATGAAAGCTTTTAATACTGAGGAAG--------------- O_garnettii300722 A----GAGAGATGAAAGCTTTTAATACTGAGGGGA--------------- P_troglodytes300277 A----A-GTGATGATAAACTAT-GT-CTGAGGGGA--------------- P_troglodytes300397 -----AAGTAATGATACAGTAT-AT-CTGAGGAGA--------------- P_troglodytes300523 A----GAGAGATGAGAGCCTTTTAGGCTGAGGAA---------------- P_troglodytes300524 -----AAGTGAAGATAAAGTGT-GT-CTGAGGAGA--------------- P_troglodytes300628 -----AAGTGATGATAAAGTCT-GT-CTGAGGAGA--------------- P_pygmaeus300054 -----AAGTAATGATACAGTAT-AT-CTGAGGAGA--------------- P_pygmaeus300198 A----A-ATGATGATAAACTAT-GT-CTGAGGGGA--------------- P_pygmaeus300594 -----AAGTGAAGATAAAGTGT-GT-CTGAGGAGA--------------- P_pygmaeus300595 A----GAGAGACGAGAGCCTTTTAGGCTGAGGAA---------------- P_pygmaeus300719 -----AAGTGATGATAAAGTCT-GT-CTGAGGAGA--------------- R_norvegicus300910 T----AAGTGAGGATGAAG-TGTAT-CTGAGGAGA--------------- R_norvegicus300911 A----ATGAGATGAATA-CTTTAGTGCTGAAGAAG--------------- S_cerevisiae300025 AA---ATAATAGGAAGATAACCAATTTTACCAAAGCTCAAATCTGATT-- S_araneus300073 A----AAGTGACGATAAAGTGT-AT-CTGAGGAGA--------------- S_araneus300779 G----AAGTTATGATAAAGTAT-AT-CTGAGA------------------ S_araneus301049 A----AAGCGATGAA-GCCTATAGATCTGAGGAAG--------------- S_araneus301050 A----AAGTGACGATAAAGTGT-AT-CTGAGGAGA--------------- S_tridecemlineatus300292 A----AAGAGATGAATGCCTTTAATGCTGAGGAGG--------------- S_tridecemlineatus300293 -----AAGTGATGATAAAATGT-AT-CTGAGGAGA--------------- T_nigroviridis300143 -----AAGTGGTGATAGCA-AAGACTCTGAGAA----------------- T_belangeri300369 A----AAGTGATGAAAGCCTTTAATGCTGAGGAA---------------- T_belangeri300370 T----CAGTGATGATGAAG-TGTGT-CTGAGGAGA--------------- X_tropicalis300101 A----T-GCGATGATATTTCT-GAATCTGAAGAAG--------------- X_tropicalis300102 A----T-GTGGTGATATTTGT-CAACCTGAAGAAG--------------- X_tropicalis300103 A----T-GTGGTGATATTTGT-CAACCTGAAGAAG--------------- X_tropicalis300104 G----T-ACGATGATATTCCT-TAATCTGAAGAAG--------------- * A_thaliana300170 ------------------ A_thaliana300171 ------------------ A_thaliana300172 TTTGTCTTTCTTCTGAGT C_elegans300029 ------------------ C_familiaris300433 ------------------ C_familiaris300434 ------------------ C_porcellus300936 ------------------ D_novemcinctus300067 ------------------ D_novemcinctus300257 ------------------ D_novemcinctus300485 ------------------ D_melanogaster300151 ------------------ E_telfairi300829 ------------------ E_telfairi300830 ------------------ E_caballus300286 ------------------ E_caballus300287 ------------------ F_catus300272 ------------------ G_gallus300102 ------------------ G_gallus300103 ------------------ G_aculeatus300016 ------------------ G_aculeatus300017 ------------------ G_aculeatus300018 ------------------ G_aculeatus300132 ------------------ H_sapiens300610 ------------------ H_sapiens300663 ------------------ H_sapiens300664 ------------------ L_africana300338 ------------------ M_mulatta300437 ------------------ M_mulatta300484 ------------------ M_mulatta300580 ------------------ M_mulatta300581 ------------------ M_mulatta300598 ------------------ M_murinus300449 ------------------ M_murinus300450 ------------------ M_domestica300074 ------------------ M_domestica300075 ------------------ M_musculus300108 ------------------ M_musculus300954 ------------------ M_musculus300955 ------------------ O_anatinus304515 ------------------ O_cuniculus300460 ------------------ O_cuniculus300461 ------------------ O_latipes300085 ------------------ O_latipes300086 ------------------ O_garnettii300257 ------------------ O_garnettii300465 ------------------ O_garnettii300688 ------------------ O_garnettii300722 ------------------ P_troglodytes300277 ------------------ P_troglodytes300397 ------------------ P_troglodytes300523 ------------------ P_troglodytes300524 ------------------ P_troglodytes300628 ------------------ P_pygmaeus300054 ------------------ P_pygmaeus300198 ------------------ P_pygmaeus300594 ------------------ P_pygmaeus300595 ------------------ P_pygmaeus300719 ------------------ R_norvegicus300910 ------------------ R_norvegicus300911 ------------------ S_cerevisiae300025 ------------------ S_araneus300073 ------------------ S_araneus300779 ------------------ S_araneus301049 ------------------ S_araneus301050 ------------------ S_tridecemlineatus300292 ------------------ S_tridecemlineatus300293 ------------------ T_nigroviridis300143 ------------------ T_belangeri300369 ------------------ T_belangeri300370 ------------------ X_tropicalis300101 ------------------ X_tropicalis300102 ------------------ X_tropicalis300103 ------------------ X_tropicalis300104 ------------------

Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved