snOPY snoRNA Orthological Gene Database
Xenopus_tropicalis SNORD24
sequence
TGCAAGTGATGTGATGAAATATTTGCTATCTGAGCCACAGTGCTGACACTCTACCCACC
AAGATCGCTGATGCA
  Box motif
  Complementary to target RNA
length 74
organism Xenopus_tropicalis
snoRNA name SNORD24
alias
chromosome ⁄ contig scaffold_878
locus ⁄ host gene Mono:17:SNORD24
organization Mono
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved