snOPY snoRNA Orthological Gene Database

Family: SNORD24

CLUSTAL 2.0.10 multiple sequence alignment A_thaliana300157 -------GAAAGTGATGA-TAAGGAATTGTCGCCCCAGGCTTAATCTGCA A_thaliana300158 -TTTGAGGAAAGTGATGA-TATGAAATTGTCGCCCCAGGCTTAATCTGCA C_elegans300024 ---GTTGTCAG-TGACG--ATATTACTTACCGCCCC-AGGCAT---AGTG C_familiaris300107 ---CTCACCAG-TGATG--AA-TTCAATACCGCCCC-AGTCTG---ATCA C_porcellus300576 ---CTCACCAG-GGATG--AAATTGAATACCGCCCCCAGTCTG---ATCA D_rerio300006 --ATAGGTGTGATGATT--T-TAG-ATTACCGCCCC-AGTCTG---ATTT D_rerio300013 --ATAGGCATGATGATC--T-TAG-ATTACCGCCCC-AGTCTG---ATTT D_rerio300225 -TATGGACATGATGAG----TGACTATTACCGCCCC-AGGCTG---AAAA D_novemcinctus300092 ---CTCACCAG-TGATG--AG-TTGAATACCGCCCC-AGTCTG---AAAA D_melanogaster300154 ---CTTACATGATGAT---TTTATTCGTACCGCCCC-AGTCTG---AAGA D_melanogaster300164 ---TTTTTATGATGAT---TTCGT--ATACCGCCCC-AGTCGG---AGAA D_melanogaster300165 ---TTTTTGTGATGAT---TTCGT--ATACCGCCCC-AGTCGG---AGAA D_melanogaster300166 ---ATATTATGATGAT---TAAGG--ATACCGCCCC-AGTCGG---AGAA E_caballus300028 ---CTCACCAG-TGATG--AG-TTCAATACCGCCCC-AGTCTG---ATTA E_europaeus300059 ---ATTACTAG-TGATG--AA-TTCATTGCCACCC--AGTCTG---ATCG E_europaeus300488 ---CAAACTAA-TGATG--AA-TTCACTACTGCCCC-AGTTTA---ATCA F_catus300027 ---CTCACCAG-TGATG--AA-TGCAATACCGCCCC-AGTCTG---AACA G_aculeatus300076 ------CTCAAGTGATGAGTTATTTATTACCGCCCCAGTCTGA----GAA G_aculeatus300077 ATTTTGATGTGATGAG-----TAT---TACCGCCCC-AGTCTG---AGAA G_aculeatus300103 ---TTGATGTGATGAT-----TAT---TACCGCCCC-AGTCTG---AAAA G_aculeatus300104 ---TTGATGTGATGAT-----TAT---TACCGCCCC-AGTCTG---ATAA G_aculeatus300105 ATTTTGATGTGATGAG-----TAT---TACCGCCCC-AGTCTG---AGAA H_sapiens300163 ---CTCACCAG-TGATG--AG-TTGAATACCGCCCC-AGTCTG---ATCA H_sapiens300601 ---ACCACCAG-TGATG--AG-TTGAATACTGCCCC-AGTCTG---ATCA L_africana300011 ---ATCACCAG-TGATG--AG-TTGAATACCGCCCC-AGTCTG---ATCA M_mulatta300226 ---CTCACCAG-TGATG--AG-TTGAATACCGCCCC-AGTCTG---ATCA M_mulatta300428 ---ATCACCAG-TGATG--AG-ATGAATACTGCCCC-TTTCTG---ATCA M_murinus300333 ---CTGACCAG-GAATG--AA-TTGTGTACTGTCCC-AGTCTGTG-ATCG M_murinus300337 ---TGAACTAG-GAATG--AG-TTGCATACTGCCCC-AGTGTGTG-ATCA M_murinus300361 ---CTCACCAG-TGATG--AG-TTGAATACCGCCCC-AGTCTG---ATCA M_domestica300066 ---CCCACCAG-TGATG--AG-ACGATTACCGCCCC-AGGCTG---ATTC M_musculus300715 ---CTCACCCT-G-ATG--AA-CTGAATACCGCCCC-AGTCTG---ATAG O_anatinus302951 --AATATTCTG-TGATG--AA--TCTATACCGCCCC-AGTCTG---ATCA O_anatinus304215 --AATATTCTG-TGATG--AA--TCTATACCGCCCC-AGTCTG---ATCA O_cuniculus300014 ---CTCACTAG-TGATG--AG-TCTGATACCGCCCC-AGTCTG---ATCA O_cuniculus300347 ---CTCACTAG-TGATG--AG-TCTGATACCGCCCC-AGTCTG---ATCA O_latipes300034 ---CAGACGTGATGAG----TTCCTATTACCGCCCC-AGTCTG---AGAA O_latipes300035 ---CAGAAAGGATGAAG--TTTACTTATACCGCCCC-AGTCTG---AAAG O_garnettii300315 ---TTTACCAG-TGCTG--AG-TTGAATACCACCCC-AGTCTG---ATAA O_garnettii300575 ---CTCACCGG-TGATG--AG-TTGAATACCGCCCC-AGTCTG---ATAA O_garnettii300606 ---GGCACTAG-AAGTTTTAAAAATGCTCCTGGTTCCAGTCTG---ATAA P_troglodytes300457 ---CTCACCAG-TGATG--AG-TTGAATACCGCCCC-AGTCTG---ATCA P_troglodytes300740 ---ACCACCAG-TGATG--AG-TTGAATACTGCCCC-AGTCTG---ATCA P_pygmaeus300535 ---CTCACCAG-TGATG--AG-TTGAATACCGCCCC-AGTCTG---ATCA P_pygmaeus300541 ---CTCACCAG-TGATG--AG-TTGAATACCGCCCC-AGTCTG---ATCA P_pygmaeus300716 ---ACCACCAG-TGATG--AG-TTGAATAATGCCCC-TT-CTG---ATCA R_norvegicus301100 ---CTCACCCT-G-ATG--AA-CTGAATACCGCCCC-AGTCTG---ATAG S_araneus300141 ---CTCACCAG-TGATG--AA-TTCAATACCGCCCC-AGTCTG---ATCA S_tridecemlineatus300121 -----TAC-AA-ATATTTCAGCAGTATTACTCAGCCTAGTGAG---ACCA S_tridecemlineatus300194 ---CTCACCAG-TGATG--AG-TTGAATACCGCCCC-AGTCTG---ATCA T_nigroviridis300128 ---CCCACCAAATGATG--AG-TACGTTACCGCCCC-AGTCTG---ATAA T_nigroviridis300129 ----GAGTCAGATGATG--AGTTA-GTTACCGCCCC-AGTCTG---ATTA T_belangeri300017 ---CTCACCAG-TGATG--AG-T-TGATACCGCCCC-AGTCTG---ATCA X_tropicalis300010 ------AAAACCTGATG--AGTTCTATTACCGCCCC-AGTCTG---ATTA X_tropicalis300013 ---TTCAGCTG-TGATG--AT--CGTATACCGCCCC-AGTCTG---ATGT * A_thaliana300157 TCCATTACGATGGTTGTAACATGGTGATTGACTATCTCTGTCTGATTC-- A_thaliana300158 TCCATTACGATGGTTGTAACATGGTGATTGACTATTTTTGTCTGATTCTC C_elegans300024 TTTGTGA---TGATTGGT---TTATTCCGAGACTT--------------- C_familiaris300107 CC-GTGAC--TGAAAGGT---ATTTTCTGAGCAGTG-------------- C_porcellus300576 CT-GTGACA-GAAAAGGT---ATTTTCTGAGTTGAG-------------- D_rerio300006 ATC-TGAC--TGATTGGT--ACCCCTCTGAACCTTT-------------- D_rerio300013 ATC-TGAC--TGATTGGT--ACCCCTCTGACCTCT--------------- D_rerio300225 GTTATGAC--TGATTGGT-ATCCCCTCTGATCCATA-------------- D_novemcinctus300092 CT-ATGAC--TGAAAGGT---ATT-TCTGAGCTGTG-------------- D_melanogaster300154 GACGTG-T--TGATTGGTTATTTATACTGATA------------------ D_melanogaster300164 ATGATG-T--CGATTGGAATTATTTACTGATT------------------ D_melanogaster300165 ATGATG-T--CGATTGGAATAATATACTGATA------------------ D_melanogaster300166 ATTATG-T--CGATTGGTTAAACATACTGACT------------------ E_caballus300028 CT-GTGAC--TGAAAGGT---ATTCTCTGAGCTGTG-------------- E_europaeus300059 CT-GTGAC--TGATAGGT---ATTTCCTGAGCTGTG-------------- E_europaeus300488 CT-GTGAC--TGATAGGT---GTTTTCTGAGCTGTG-------------- F_catus300027 CT-GTGAC--TGAAAGGT---ATTCTCTGAGCTGTG-------------- G_aculeatus300076 TTCATGAC--TGATTGGTTCACTCTGATTGAG------------------ G_aculeatus300077 TTCATGAC--TGATTGGTTACTCTGATCAAAT------------------ G_aculeatus300103 TTCATGAC--TGATTGGTTACTCTGATCAA-------------------- G_aculeatus300104 TTCATGAC--TGATTGGTTACTCTGATCAA-------------------- G_aculeatus300105 TTCATGAC--TGATTGGTTACTCTGATCAAAT------------------ H_sapiens300163 AT-GTGTGACTGAAAGGT---ATTTTCTGAGCTGTG-------------- H_sapiens300601 AC-ATGCG--TGAAAGAT---ATTTTCTGAGCTGTG-------------- L_africana300011 CT-GTG--ACTGAAAGGT---ATTT-CTGAGCTGTG-------------- M_mulatta300226 AT-GTG--ACTGAAAGGT---ATTTTCTGAGCTGTG-------------- M_mulatta300428 AT-ATGCG--TGAAAGAT---ATTTTCTGAGCTGTG-------------- M_murinus300333 CT-GTAAC--TGAAAGGT---ATTTTCTGAACTGTG-------------- M_murinus300337 CT-GTGAC--TGAAAGGT---GTCTTCTGAGCTGTG-------------- M_murinus300361 CT-GTGAC--TGAAAGGT---ATTTTCTGAACTGAG-------------- M_domestica300066 CT-GTGAC--TGATAGGT----TGTTCTGAGTGGG--------------- M_musculus300715 CT-GTGG---AGAAAGGT---ATTTTCTGAGTTGTG-------------- O_anatinus302951 TT-GTGAC--TGAAAGGT---A-ATTCTGAGCTGTC-------------- O_anatinus304215 TT-GTGAC--TGAAAGGT---A-ATTCTGAGCTGTC-------------- O_cuniculus300014 CT-GTGAC--TGAAAGGT---ATTTTCTGACCTGTG-------------- O_cuniculus300347 CT-GTGAC--TGAAAGGT---ATTTTCTGACCTGTG-------------- O_latipes300034 TTCATGAC--TGATTGGTTAACCCCTCTGATCTTTG-------------- O_latipes300035 TTCATGAC--TGATTGGT-ATCCCCTCTGATCTG---------------- O_garnettii300315 CT-GTGAC--TGAAAAGT---ATTTTCTGAACTGAG-------------- O_garnettii300575 CT-GTGAC--TGAAAGGT---ATTTTCTGAACTGAG-------------- O_garnettii300606 CT---GTGACTGAAAGGT---ATTTTCTGAACTGAA-------------- P_troglodytes300457 AT-GTGTGACTGAAAGGT---ATTTTCTGAGCTGTG-------------- P_troglodytes300740 AC-ATGCG--TGAAAGAT---ATTTTCTGAGCTGTG-------------- P_pygmaeus300535 AT-GTGTGACTGAAAGGT---ATTTTCTGAGCTGTG-------------- P_pygmaeus300541 AT-GTGTGACTGAAAGGT---ATTTTCTGAGCTGTG-------------- P_pygmaeus300716 AT-AGGCA--TGGAAGAT---ATTTTCTGAGCTGTG-------------- R_norvegicus301100 CT-GTGG---AGAAAGGT---ATTTTCTGAGTTGAG-------------- S_araneus300141 CT-GTGAC--TGAAAGGT---ATT-TCTGAGCTGTG-------------- S_tridecemlineatus300121 CT-ATGTGATAGAAAGGT---ATTTTCTTACCTGTT-------------- S_tridecemlineatus300194 TT-GTGAC--AGAAAGGT---ACACTCTGAGTTGTG-------------- T_nigroviridis300128 CTCGTGAC--TGATGGGT---ATTTTCTGACTGAA--------------- T_nigroviridis300129 TTCATGAC--TGATTGGT--ATCC-TCTGAATAA---------------- T_belangeri300017 CT-GTGAC--TGATAGGT---ATTTTCTGAGCTGTG-------------- X_tropicalis300010 TCTGTGAC--TGAATGGT---ATCTTCTGA-TTGC--------------- X_tropicalis300013 CC-GTGAC--TGAGTGGT---ACAATCTGAGCTGCA-------------- A_thaliana300157 ----- A_thaliana300158 TCAAA C_elegans300024 ----- C_familiaris300107 ----- C_porcellus300576 ----- D_rerio300006 ----- D_rerio300013 ----- D_rerio300225 ----- D_novemcinctus300092 ----- D_melanogaster300154 ----- D_melanogaster300164 ----- D_melanogaster300165 ----- D_melanogaster300166 ----- E_caballus300028 ----- E_europaeus300059 ----- E_europaeus300488 ----- F_catus300027 ----- G_aculeatus300076 ----- G_aculeatus300077 ----- G_aculeatus300103 ----- G_aculeatus300104 ----- G_aculeatus300105 ----- H_sapiens300163 ----- H_sapiens300601 ----- L_africana300011 ----- M_mulatta300226 ----- M_mulatta300428 ----- M_murinus300333 ----- M_murinus300337 ----- M_murinus300361 ----- M_domestica300066 ----- M_musculus300715 ----- O_anatinus302951 ----- O_anatinus304215 ----- O_cuniculus300014 ----- O_cuniculus300347 ----- O_latipes300034 ----- O_latipes300035 ----- O_garnettii300315 ----- O_garnettii300575 ----- O_garnettii300606 ----- P_troglodytes300457 ----- P_troglodytes300740 ----- P_pygmaeus300535 ----- P_pygmaeus300541 ----- P_pygmaeus300716 ----- R_norvegicus301100 ----- S_araneus300141 ----- S_tridecemlineatus300121 ----- S_tridecemlineatus300194 ----- T_nigroviridis300128 ----- T_nigroviridis300129 ----- T_belangeri300017 ----- X_tropicalis300010 ----- X_tropicalis300013 -----

Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved