snOPY snoRNA Orthological Gene Database

Family: SNORD24

CLUSTAL 2.0.10 multiple sequence alignment H_sapiens300433 AAGACTC--CTTTCAGGAATCATTTCTTTAGTTCCT-ACTAGAGAGGCTT-CTCTTAACA T_nigroviridis300109 AAGACTATACTTTCAGGGATCATTTCTATAGTTCCTAACTTGAGAAATGTGTTTCTAAAG T_nigroviridis300130 AAGACTATACTTTCAGGGATCATTTCTATAGTTCCTGACTTGAGAAATGTGTTTCTAAAG T_nigroviridis300149 CAGACTTTACTCTCAGGGATCATTTCTTTAGTTGTTGACT-GAGAAATGTGTTTCTAAAG T_nigroviridis300151 CAGACTTTACTCTGAAGGATCATTTCTTTAGTTGTTGACT-GAGAAATGTGTTTCTAAAG T_nigroviridis300152 CAGACGTTACT-TCCAGGATCTTTTCTTCAGCTGGTGACT-GAGAAATGTGCTTCTGAAG T_nigroviridis300153 CAGACTTTACTCTCAGGGATCATTTCTTTAGTCGTTGACT-GAGAAATGTGTTTCTAGAG T_nigroviridis300166 GTGACTTTACTCGCAGGGATCATTTCTTTAGTTGGTGGCT-GAGAAATGTGTTTCTAGAA T_nigroviridis300171 CAGACTTTACTCTGAGGGATCATTTCTTTAGTTGTTGACT-GAGAAATGTGTTTCTGAAG T_nigroviridis300172 CAGACTTTACTCTGAAGGATCATTTCTTTAGTTGTTGACT-GAGAAATGTGTTTCTAAAG *** ** * *** ***** ** * ** **** * * * H_sapiens300433 TGTGGAGCGCTGGAAACCACAAAGAGGAGGTGC-AGCATTCAGTTCTAAGTGTGAAGTGG T_nigroviridis300109 TGATTGGTCTCGCTACCCACGATGAAGAGTCGT-GATGTTCCTTTCTGAGCGCGAAAAGG T_nigroviridis300130 TG-TTGGTCTCGCTAACCACGATGAAGAGGTGGTGATGCTCCTCTCTGAGCGCGAAGCGG T_nigroviridis300149 AGTTTGGTCTCACTGCCCACGATGAAGAGCTGA-GATGTTTCCTTCAGAGCAGGAAG--- T_nigroviridis300151 AGTTTGGTCTCACTGCCCACGATGAGGAGCTGA-GATGTTTCCTTCAGAGCAGGAAG--- T_nigroviridis300152 AGTTTGGTCTCACT-CCCACGAAGA----------------------------------- T_nigroviridis300153 AGTTTGGTCTCACTGCCCACGATGAAGAGCTGA-GATGTTTCCTTCAGAGCAGGAAG--- T_nigroviridis300166 AGTTTGGTCTCACTGCCCACGATGAAGAGCTGA-GATGTTTCCTTCAGAGCAGGAAG--- T_nigroviridis300171 AGTTTGGTCTCACTGCCCATGATGAAGAGCTGA-GATGTTTCCTTCAGAGCAGGAAG--- T_nigroviridis300172 AGTTTGGTCTCACTGCCCACGATGAAGAGCTGA-GATGTTTCCTTCAGAGCAGGAAG--- * * *** * ** H_sapiens300433 A-TTCTTGGTGTTGCTGTGCTGCAACTGCCATTTGCTAATGATGACCTTGCTTTTCTTAC T_nigroviridis300109 ACCCAGATTAATGATTCAGTTCATATGATC-TCGGTCGTTGATGAACGTTCGGCTCTCC- T_nigroviridis300130 GCAGAGAAACTTGATTCACTTCATGTGTTC-TCTGCTTTTGATGACCGTTCAGCGCCTCC T_nigroviridis300149 --CTGGTGGGAAGACTCTGCTTCT----TC-TCCACTGATGAAGACTGTTCAGAGGTTC- T_nigroviridis300151 --CTGGTGGGAAGACTTTGCTTCT----TC-TCCACTGATGAAGACTGTTCAGAGTTTC- T_nigroviridis300152 -----------------TGTTTCT----CC-TCCACTGATGAAGACTCTCCAGAGTTTC- T_nigroviridis300153 --CTGGTGGGAAGACTCTGCTTCT----TC-TCCACTGATGAAGACTGTTCAGAGGTCC- T_nigroviridis300166 --CTGGTGGGAAGACTCTGCTTCT----TC-TCCACTGATGAAGACTGTTCAGAGGTCC- T_nigroviridis300171 --CTGGTGG-AAGACTTTGTTTCT----TC-TCCACTGATGAAGACTGTTCAGAGTTTC- T_nigroviridis300172 --CTGGTGG-AGGACTTTGCTTCT----TC-TCCACTGATGAAGACTGTTCAGAGTTTC- * * * *** ** * * H_sapiens300433 TTAGAGTAAGACAGAGAGACAGCAGTCAGCCTAAGCGGT T_nigroviridis300109 -TTCGGGAGAGTTGAGGAAGGGAACATGATCAGAGTGG- T_nigroviridis300130 ATCCGGGGCT-TTGAGGGGAGGAGCATGATCAGAGTGG- T_nigroviridis300149 -TCTGAGACT-CTGGTGAAGGAGACAGGATCTGAGTGG- T_nigroviridis300151 -TCTGAGACT-CTGATGAAGGAGACATGATCTGAGTGG- T_nigroviridis300152 -TCTGAGAC---TGGTGAAGGAGACATGAGCAGAGTGG- T_nigroviridis300153 -TCTGAGACT-CTGATGAAGGAGACATGATCTGAGTGG- T_nigroviridis300166 -TCTGAGACT-CTGATGAAGGAGACATGATCTGAGTGG- T_nigroviridis300171 -TTTGAGGCT-CTGATGAAGGAGACATGATCTGAGTTG- T_nigroviridis300172 -TCTGAGACT-CTGATGAAGGAGACATGATCTGAGTGG- * * * ** *

Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved