snOPY snoRNA Orthological Gene Database
Tupaia_belangeri SNORA16
sequence
TTAGGCTATTATCGAAGCTGCAGCTGCTTCCGCGTAGCTGCTGTGGTCAAAGAGGAGCC
CAGAGTGAGTTTCCCCGACCGTCACCGTCCGGCCTGGCCTGCCGTGGCTGGTCTGCAACA
TTGTGGGGAAAGACAGCC
  Box motif
  Complementary to target RNA
length 137
organism Tupaia_belangeri
snoRNA name SNORA16
alias
chromosome ⁄ contig GeneScaffold_20
locus ⁄ host gene THSD7A
organization Intronic
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved