snOPY snoRNA Orthological Gene Database

Family: SNORA16

CLUSTAL 2.0.10 multiple sequence alignment C_familiaris300071 --CCTGGCCCTTATCGAAGCTGCAGCTGCTTCCA---CATA-GCTGCTGT C_familiaris300296 ------ATTAGAATCAAAGATGCAGTTGCTTTCA---CATA-GAAGCAGC C_porcellus300146 --GGTGGCCCTTATCGAAGCTGCAGCTGCTTGTA---CATA-GTTGCTGC C_porcellus300395 --AGTGGCCCTTATCGAAGCTGCAGCTGCTTGTA---TGTA-GTTGCTGC C_porcellus300728 --AGTGGCCCTTATCGAAGCTGCAGCTGCTTGTA---TGTA-GTTGCTGC C_porcellus300782 --TGTGGCCCTTATCGAAGCCGCAGCTGCCTGTA---CGTA-GTTGCTGC C_porcellus300865 ------------------AGTAGAATATATTGCT---GC----------- D_rerio300264 --CATGGCCCTGATTGAAGCTGTCCAGTTTGTCT----GTAACTGGTGCA D_rerio300265 --CAAGGCCCTGATCGAAGCTGTCCTGTTCATCT----ATAGCAGGTACT D_novemcinctus300058 --ATTAGTCAGCATTAAATCTGCAGATGGCTTCC---ACTA-AGTACTAC D_novemcinctus300326 --CGTGTTTCTACTCAAAGCTGCACCTGTTTTCA---CATA-GTTACTAT D_novemcinctus300328 --TGTGGCTCTCATCAAAGCTGCAGCTGCTTCCA---CATA-GCTACTGG D_novemcinctus300367 --AGTTGCTCTCATCAAAGCTGCAGCTGCTTCCA---CATA-GCTACTGT D_novemcinctus300391 --CACGGCCCTTATCGAAGCGGCAGCTGCTTTCA---CATA-GCTCCTGT D_novemcinctus300468 ---------AAGACCCCAAATAAACACCTTTGTT---GCCT-TGCAAAAA D_novemcinctus300469 --GTTGGCTCTCATCGAAGCTGCAGCTGCTTCCC---CATA-GCTACTGT D_novemcinctus300489 --GGTGGCTCTCATCAAGGCTGCAGCTGCTTCCA---CATA-GCTACTGA D_novemcinctus300505 --GGTGGCTCTCGTCGAAGCTGCAGATGCTTCCA---CAAA-GCTACTCT D_melanogaster300107 ---AGGGCTTTGTCGAAGACCGTTTTGCGTGTAGAATAGTGCGCCGATTG D_melanogaster300108 ---TGGGCTACGTCGAAGACCGATTTCCGCTTGTTGCCATGTGTCTATTG D_melanogaster300109 ---TTGGCTGGTTCGAAGACCACAAAACGCTCCTCGAAAGTTGCGTGGTT E_telfairi300054 --AGGGGCCCTTATCGAAGCTGCAGTTGCTTCCA---CGTA-GCTGATGT E_telfairi300108 --TGGGACCCTTATCGAAGCTGAAGTTGCTTCCA---CGTA-GCTGCTGT E_telfairi300394 --AGGGGCCCTTATCGAAGCTGCAGTTTCTTCCA---CGTA-GCTGCTGT E_telfairi300617 ------AAGAAAATGTTTTGAAAATGATGATGGC---CGTA-GCTGCTGT E_telfairi300643 --TGTGGCTCTTATTGAAGCTGCAGTTGCTTCCA---CATA-GCTGCTGT E_telfairi300711 --AGTGGCTCTTATCAAAGCTGCAGTTGCTTCCA---CATA-GCTGCTGT E_telfairi300713 --AGTGGCCCTTATCGAAGCTGCAGTTGCTTCCA---CCGATGCTGCGGT E_caballus300001 --TGTGGCCCTTATCGAAGCTGCAGCTGCTTCCA---CATA-GCTGCTGT E_caballus300139 -----AAAAGGGATTAAAGGTGCAGCTGCTTTCC---CATT-TAAGCAGC E_europaeus300287 --TGTGGTCCTTATCGAAGCTGCAGCTGTTTCCA---TTTA-GCTGCTGT E_europaeus300344 --AGTGGCCCTTATCAAAGCTGCAGCTGCTTCCA---TTTA-CCTGCTGT E_europaeus300423 --TGTGACCCTTATCGAAGCTGCAGCTGCTTCCA---TTTA-GCTTCTGT H_sapiens300654 --CTTGGCCCTTATCGAAGCTGCAGCTGCTTCCG---CATA-GCTGCTGT H_sapiens300677 --TATGGCCTTTATCAAAGCTGCAGCTGCTTCCA---TGTA-GCTGCTGT L_africana300204 --AAAAGTTAGTATCAAAGATGCAGCTGCTTTTG---CGTT-TCTACAGC M_mulatta300128 --GGCGGCTCTCATCGCAGCTGCAGCTGCTTCCA---CATA-GCTGCTGT M_mulatta300217 --CTTGGCCCTTATCGAAGCTGCAGCTGCTTCCG---CATA-GCTGCTGT M_mulatta300565 --AGTGGCCCTTATCAAAGCTGCAGTGGTTTCTA---CATA-GCTGCTGT M_mulatta300590 --TATGGCCTTTATCAAAGCTGCAGCTGCTTCCA---TGTA-GCTGCTGT M_mulatta300738 --AAAAATTGGGACCAAAGATTCAGCTGTCTTCC---CATT-TAAGCAGC M_murinus300083 --AGGGACCCTTATCAGGGCTGTGGTGGCCTCCA---CACA-GCTGCTGT M_murinus300124 --CATTACCCTTATCAAAGTTGCA---GCTTCCA---CATA-GCTGCTGT M_murinus300238 --TGTGGACATTATGGAAGCTGCAGCTGCTTCCA---CCCA-GCTGCTGT M_murinus300383 --CGTGGCCCTTATCGAAGCTGCAGCTGCTTCCA---CATA-GCTGCTGT M_murinus300404 -------TTAGGATCAAAGATGCAGCTGCTTTCC---CATT-TAAGCAGC M_murinus300461 --AGTGGCCCTTATTGAAGCTGCAGCTGCT------------------GT M_murinus300514 --CATAGTACATATGAAATGTACTATTTAATATA---AAAA-AGAAATGT M_domestica300064 --CCAGGCCCTTATCGAAGCTGCACCAGCTCTTC---TATA-GCTGTTGC M_musculus300610 --TGTGGCCCTTATCGAAGCTGCAGCAGCTTCTA---CATA-GCTGCTGT M_musculus300015 --GGCAGCCCTTATCAAAGCTGCAGCTGTTTCCA---CATA-GCTGATGT O_cuniculus300329 --GGTAGCCCTTATCAAAGCTGCAGCCGCTTCCA---CATA-GCAGCTCT O_cuniculus300388 --CGCGGCCCTTATCGAAGCTGCAGCTGCTTCCA---CATA-GCAGTTGT O_cuniculus300489 --------------------------TGTTGTCC---CAGG-TAAGCAGT O_garnettii300045 --TTTGGTCCTTAGTGAAGCTGCAGCTGCTTCCA---CATG-GGTGCTGT O_garnettii300198 ----------------------GGTGACATTCCA---CATA-TCTGCTGT O_garnettii300348 ---GGCTGGTTTATGGAAAGCA----TAAGAGTG---CACG-GCTGCTGT O_garnettii300375 --AGTGGCCCTTATCGAAGCTGCAGCTGCTTCCA---TATA-GCTGCTGT O_garnettii300469 -------GACTTTCCTAGTTTAA-ACTTAATATT---ATAA-CTGC-TGT O_garnettii300518 --TGTGGCCCTTATCGAAGCTGCAGCTGCTTCCA---TATA-GCTGCTGT O_garnettii300589 --TGTGGACATTACGAAAGCCGCAGCTCCTTCAC---CTCA-GCTGCTAT O_garnettii300663 --AATGGCCCTCACCAAAGCTGCAGCTGCTTCCC---CATG-GTTGCTGA O_garnettii300747 --CGTGGCCCTTATTGAAGCTGCAGGTGCTTCCA---CATC-TCTGCTGT P_troglodytes300043 --GGCGGCCCTTATCACAGCTGCAGCTGCTTCCA---CATA-GCTGCTGC P_troglodytes300514 --CTTGGCCCTTATCGAAGCTGCAGCTGCTTCCG---CATA-GCTGCTGT P_troglodytes300536 --TATGGCCTTTATCAAAGCTGCAGCTGCTTCCA---TGTA-GCTGCTGT P_troglodytes300739 --AAAAATTGGGATCAAAGATGCAGCCGCCTTCC---CATT-TAAGCAGC P_pygmaeus300027 --AGCGGCCCTTATCACAGCTGCAGCTGCTTCCA---CATA-GCTGCTGC P_pygmaeus300583 --TATGGCCTTTATCAAAGCTGCAGCTGCTTCCA---CGTA-GCTGCTGT P_pygmaeus300604 --CTTGGCCCTTATCGAAGCTGCAGCTGCTTCCG---CATA-GCTGCTGT P_pygmaeus300714 --AAAAATTGGGATCAAAGATGCAGCTGCCTTCC---CATT-TAAGCAGC R_norvegicus300057 --GGCAGCCCTTATTAAAGCTGTAGCTGCTTCCA---CATA-GCTGGTGT S_cerevisiae300062 ----ATGGCCTCTTCGAAGATCCGTAGATTTTGCATTTTTGCGGTGGTTT S_araneus300120 -----------GGTGACACTTAC---TGACGCCG---TGTG-ACCGCTGT S_araneus300399 -----------AGTGGCCCTTAT---TGA-----------A-GCTGCTGT S_araneus300461 --TGTGGCCCTTATCGAAGCTGCAGCAACTTCCA---CATA-GCTGCTGT S_araneus300518 -ATGTGGCCAG-ATTGAAGCTTCGGCAGCTTTGC---CACA-GCTGCTGT S_tridecemlineatus300186 --CCTGGCCCTTATCGAAGCTGCAGCTGCTTCCA---CATA-GCTTCTGT T_nigroviridis300177 CGACAGGCTCCGATCGAAGCCGTTCGTGCTCCCT----GTAGCAGCGAAC T_belangeri300006 --TGCAGGCCTTATCAAAGCTGCAGCTGCTTTTC---TGTA-GCCGCTGT T_belangeri300015 --AGCGGCCCTTATCGAAGCTGCAGTTGCTTCCG---CGTA-GCCACTGT T_belangeri300038 --CGCGGCCCTTATCGAAGCTGCAGCTGCTTCCG---CGTA-GCCGCTGT T_belangeri300071 --CACGGCCCTTATCGAAGCTGCAGCTGCTTCCG---CGTA-GCCGCTGT T_belangeri300135 --CGCCGCCCTTATCGAAGCTGCAGCTGCTTCCG---TGTG-GCCGCTGT T_belangeri300232 --CCTGGCCTTTTCTGAAGCTGCAGCTACTTCAA----GTA-GCTGCTGG T_belangeri300277 --CGCGGCCCTTATCGAAGCTGCAGCTGCTTCCGAAGCGTA-GAGGCTGT T_belangeri300411 --TTAGGCTATTATCGAAGCTGCAGCTGCTTCCG---CGTA-GCTGCTGT C_familiaris300071 GGTCAA-AAAGG-AG---------CCCA---GAGTGACAGTTTT-CCTTG C_familiaris300296 AGTCAG--AAAAGA----------GCCT---AAATGACAGTTTT-CCTAT C_porcellus300146 AGTCAA--AAAGGAG---------CCCA---GAGTAAGAATTTT-CCTTG C_porcellus300395 AGTCAA--AAAGGAG---------CCCA---GAGTAAGAATTTT-CCTTG C_porcellus300728 AGTCAA--AAAGGAG---------CCTA---GAGTAAGAATTTT-CCTTG C_porcellus300782 AGTCAA--AAAGGAG---------CCCA---GAGTAAGAATTTT-CCTTG C_porcellus300865 AGTCAA--AAAGGAG---------CCCA---GAGTAAGAATTTT-CCTTG D_rerio300264 GATCAA--ACAGGAG---------CCGA---TAGCAACACTTTT--ACTG D_rerio300265 GGTCAA--ACAGGAG---------CCAA---TAGCAACACTTTT--ACCG D_novemcinctus300058 AGTCAA--AAAGGAG---------CCTG---GAATGACACTTTT-CCATG D_novemcinctus300326 GGTCAA--AAAGA-G---------CCCG---GAATGACAGTTTT-CCTTG D_novemcinctus300328 GGTCAA--AAAGAAG---------CCCA---GAGTG--AGTTTT-CCTTG D_novemcinctus300367 AGTCAA--AAAGGAG---------CCCA---AAGTGACAGTTTT-CCTTG D_novemcinctus300391 GGCCGA--AAAGGAG---------CCCA---GAGTGATGGCTTT-CCTTG D_novemcinctus300468 AAAAAA--AAAGGAG---------CCCA---GAGTGACAGTTTT-CCTTG D_novemcinctus300469 GGTCAA--AAAGGAG---------CCCA---GAGAGAGAGCCATGAAATA D_novemcinctus300489 GGACAA--AAAGGAG---------CCCA---GAGTGA-AGTTTT-CCTTG D_novemcinctus300505 GGCCAA--AAAGGAG---------CCCA---GAGTGACAATTTT-CCTTG D_melanogaster300107 GTTCAA--AACGAAG---------CCCA---AAGCAAT--TTTTGATACG D_melanogaster300108 GTTCAA--ATCGAAG---------CCCA---AAGCAAT--TTTTGATACG D_melanogaster300109 CAAAAA--CAATAAG---------CCAA---AAGCAAT--TTTTGTCACG E_telfairi300054 AGTCAA--AAAAGAG---------CCCA---CAGTGAGTTTTTC-CCTTG E_telfairi300108 AGTCAA--AAAAGAG---------CCCA---CATTGAGTTTTTC-C-TTG E_telfairi300394 AGTCAA--AAAAGAG---------CCCA---CAGTGAGTTTTTC-CCTTG E_telfairi300617 AGTCAA--AAAAGAG---------CCCA---CAGTGA-GTTTTC-CCTTG E_telfairi300643 AGTCAA--AAAGGAA---------CCCA---GAGTGAATTTCTC-C-TTG E_telfairi300711 GGCCAA--AAAAGAG---------CCCA---GAGTAACT-TTTT-CCTTT E_telfairi300713 AGTCAA--AAAAGAG---------CCCA---GGGTGAGTTTTCC-C-TTG E_caballus300001 GGTCAA-AAAGG-AG---------CCCA---AAGTGACAGTTTT-CCTCG E_caballus300139 TGTCAA--AAAGAG----------CCCA---ACGTGACAGTTTT-CCTGT E_europaeus300287 GGTCAA-AAAGG-AG---------CCCA---AAGTGACATTTTTTCCTTG E_europaeus300344 GGTCAA-ATAGG-AG---------CCCA---AAGTGTCATTTTT-CCTTG E_europaeus300423 GGTCAA-AAAGG-AG---------CCCA---AAGTGACATTTTT-CCTTG H_sapiens300654 GGTCAA-AAAGG-AG---------CCCA---GAGTGACAGTTTT-CCTTG H_sapiens300677 GGTCAA--AAAGAAG---------CCAA---GAGTGACAGTTTT-CCTTG L_africana300204 AGTCAA--AAAAAAAAAAAAAGACCCCA---AAGTGGCAGTTGT-CGCCT M_mulatta300128 GGTCAA--AAAGAAG---------CCCA---GAGTCAG---TTC-CCTTG M_mulatta300217 GGTCAA-AAAGG-AG---------CCCA---GAGTGACAGTTTT-CCTTG M_mulatta300565 GGTCAA-AGAGG-AG---------CCCA---GAGTGACAGTTTT-CCTTG M_mulatta300590 GGTCAA--AAAGAAG---------CCGA---GAGTGACAGTTTT-CCGTG M_mulatta300738 AC-------AGACAG---------CCCA---AAGTGACAGTTTT-CCTGT M_murinus300083 GGTCAA--AACGGAG---------CCCA---GAGTGAC---AGC-TCTTG M_murinus300124 GGTCAA--AAAGGAG---------CCCA---GAGTGACAGTTTT-CCTTG M_murinus300238 GGTCAA--AAAGGAG---------CCCA---GAGTGACAGTTTT-CCCTG M_murinus300383 GGTCAA-AAAGG-AG---------CCCA---GAGTGACAGTTTT-CCTTG M_murinus300404 AGTCAA--GAGAGTG---------CCCA---AAGTGACAGTTTT-CCTGT M_murinus300461 GGTCAA-AAGGG-GG---------CCCA---GAGTGACAGTTTT-CCTTG M_murinus300514 TATCAA--AAAGAAG---------CCCA---GAGTGACAGTTTT-CCTCG M_domestica300064 AGTCAA--AAAGGAG---------CCCA---GAGTGACAGTTTT--CTCG M_musculus300610 GGTCAA-AAAGGTGG---------CCCA---GAGAAAGAATTTT-CCTTG M_musculus300015 GGTCAA--AAATAAG---------CCTC---AAGTAACAGTTTT-CCTTA O_cuniculus300329 GGTCAA--AAGGGAG---------CCGA---GAGTGACAATTGT-CCTTG O_cuniculus300388 GGTCAA-AAAGG-AA---------CCCA---GAGCGACAGTTTT-CCTTG O_cuniculus300489 AGTCAG--AAGACAG---------CCCA---AAGTGACTTTTTC-CCTTT O_garnettii300045 GGTCAC--AAAGAAG---------CCCA---GAGTGACAGTTTT-CCTTG O_garnettii300198 GATCAA--AAAGGAG---------CCTA---GAGTGACAGTTTC-CCTTG O_garnettii300348 GGTCAC--AAGGCAG---------CCCATCGAGGTGACAGTTTC-CCTTG O_garnettii300375 GGTCAA-AGAGG-AG---------CCGA---GAGTGACAGTTTT-CCTTG O_garnettii300469 GGTCAA--AAAGGAG---------CCTC---ACGTGACAGTTTT-CCTTG O_garnettii300518 GGTCAA-AGAGG-AG---------CCTA---GAGTGACAGTTTT-CCTTG O_garnettii300589 AGCCAA--AAAGGAG---------CTCA---GAGTGACAGCCGT-CCCTG O_garnettii300663 GGTCAA--AAATGGA---------CCCC---AAGTGACAGTTGT-CCTTG O_garnettii300747 GGTCAA-AGAGG-AG---------CC-A---GAGTCACAGTTTT-CCTTG P_troglodytes300043 GGTCAA--AAAGGAG---------CCCA---GAGTCAG---TTT-CCTTG P_troglodytes300514 GGTCAA-AAAGG-AG---------CCCA---GAGTGACAGTTTT-CCTTG P_troglodytes300536 GGTCAA--AAAGAAG---------CCGA---GAGTGACAGTTTT-CCTTG P_troglodytes300739 AC-------AGACAG---------CCCA---AAGTGACAGTTTT-CCTGT P_pygmaeus300027 GGTCAA--AAAGGAG---------CCCA---GAGTCAG---TTT-CCTTG P_pygmaeus300583 GGTCAA--AAAGAAG---------CCGA---GAGTGACAGTTTT-CCTTG P_pygmaeus300604 GGTCAA-AAAGG-AG---------CCCA---GAGTGACAGTTTT-CCTTG P_pygmaeus300714 AC-------AGACAG---------CCCA---AAGTGACAGTTTT-CCTGT R_norvegicus300057 GGTCAA--ACACAAG---------TCCC---AAGTAACAGTTTT-CCTTA S_cerevisiae300062 ATGGATTCAAAGCGAGG-------CCTAAATTAACGATCATGTCTTTGCT S_araneus300120 GCTGGAGAAAAGAAG---------CCCA---GAGTGACAGATTT-TTTTA S_araneus300399 GGTCAA--AAAGGAA---------CCCA---GAGTGACAACTTT-CCTTG S_araneus300461 GGTCAA-AAAGG-AG---------CCCA---GAGTGACAGTTTT-CCTTG S_araneus300518 GGTCAA-CAGAG-AG---------CCCA---GAGTGACAGTTTT-CCTTG S_tridecemlineatus300186 GGTCAA-AAAGG-AG---------CCCA---GAGCAGCAGTTTT-CCTTG T_nigroviridis300177 GGTCAA--ACGGAAG---------CCGA---GACCAACACTTTC--ACCG T_belangeri300006 GGTCAA--AGAGGAG---------CTCA---GAGTGACAGGTTT-TCCTC T_belangeri300015 GGTCAA--AGAGGAG---------CCCA---GAGTGA--GTTT--CCCCG T_belangeri300038 GGTCAA--AGAGGAG---------CCCA---GAGTGA--GTTT--CCCCG T_belangeri300071 GGTCAA--AGAGGAC---------CCCA---GAGTGA--ATTT--CTCGG T_belangeri300135 GGTCAA--AGAGGAA---------CCCA---GAGT-----TTT--CCCTG T_belangeri300232 GGTCAA--AGAGGAG---------C------GAGTGTCACTTTC-CTCTG T_belangeri300277 CGTCA----GAGGAG---------CCCG---GAGTGA--GTTTT-CCCCA T_belangeri300411 GGTCAA--AGAGGAG---------CCCA---GAGTGA--GTTT--CCCCG C_familiaris300071 ACGGTCGCCG----------TTCTGTTTG-----ATGTAACTGATC---T C_familiaris300296 TCAACCA----------CTGTTCTGTTGT-----CTGTAACTGACT---T C_porcellus300146 ATGGTTGCCG----------TTCTGTTTG-----CTGTAACTGATC---T C_porcellus300395 ACGGTCGCCG----------TTCTGTTTG-----CTGTAACCGATC---T C_porcellus300728 ACGGTCACCG----------TTCTGTTTG-----CTGTAACTGATC---T C_porcellus300782 ACGGTCGCCG----------TTCTGTTTG-----CTGTAACCGATC---T C_porcellus300865 ACGGTCGCCG----------TTCTGTTTG-----CTGTAACCGATC---T D_rerio300264 ACGGTCGCTG----------TGCAGTT-AC----CTGTAGCTGTTTC--A D_rerio300265 ACGGTCGCTG----------TACAGTTTGC----TTGTAGCTGTCCC--A D_novemcinctus300058 ATGGTCTCCA----------TTCTATTTG-----TTCTAACTGATC---T D_novemcinctus300326 AGGGTTGCTG----------TTATGTATA-----CTCTAACTGATC---T D_novemcinctus300328 ACGGTCACTA----------TTCTGTTTG-----CTGTAACTGATC---T D_novemcinctus300367 ACCGTCGCCA----------ACCCGTTCG-----CTCTAACTGATC---T D_novemcinctus300391 ATGGTCACTG----------TTTCGTTTG-----CTGTCACTGATC---T D_novemcinctus300468 ACGGTCGCTG----------TTCTGTTTG-----CTGTAACTTATC---T D_novemcinctus300469 AGAAG-----------------------------CTGGGAGCAATGAAAC D_novemcinctus300489 GTGGTCGCCG----------TTCTGTTTG-----CTGTAACTGATC---T D_novemcinctus300505 ATGGTGGCCA----------TTCTGTTTG-----CTGTAACTGGTC---T D_melanogaster300107 ACGGTCTCTG---------ATTCGACAAA-----TCCCAGTTGATTC--A D_melanogaster300108 ACGGTCTCTG---------ATTCGGCATT-----CCACAGTCGTCTG--A D_melanogaster300109 ACGGTCTCTG---------ATGCGGCATT-----CCAAAGTCGCTTC--A E_telfairi300054 ATGGTCGCCG----------TTCGGTTTG-----CTGTAACCGATC---T E_telfairi300108 ACAGTCGCCA----------TTCGGTTTG-----CTATAACCGATC---T E_telfairi300394 ACGGTCGCCG----------TTCGGTTAG-----CTGTAACCGATC---T E_telfairi300617 ACGGTCACCG----------TTCAGTTTG-----CTATAACTGATC---A E_telfairi300643 ACGGTTGCCG----------TTCGGTTTG-----CTGTAACCGAGC---T E_telfairi300711 ATGGTCACTG----------TTCAGTTTG-----CTGTAACCGATC---T E_telfairi300713 ACGGTCGCCG----------TTCAGTGTG-----CTATAACCAACC---T E_caballus300001 ACGGTCGCCG----------TTCTGTTTG-----CTGTAACTGATC---T E_caballus300139 ACGCCCA----------CTGTTCTGTTGT-----CTGTAATTGATT---T E_europaeus300287 ACAGTCACCA----------TTCTGTTTG-----TTGTAACAGTTC---T E_europaeus300344 ATGGTCGCTG----------TTCTGTTTG-----TTATAACAGTTT---T E_europaeus300423 ACAGTCGCTA----------TTCTGTTTG-----TTGTAACAGTTG---T H_sapiens300654 ACGGTCGCCG----------TTCTGTTTG-----TTGTAACTGATC---T H_sapiens300677 ATGGTCATAG----------TTCTGTTTG-----CTGTAACTGATC---T L_africana300204 T-GGCCA----------CTGTTCTGTGAT-----CTGTAACTGATT---T M_mulatta300128 ACCATCA----------CCATTCTGTTTG-----CTATAACTGATC---T M_mulatta300217 ACGGTCGCCG----------TTCTGTTTG-----TTGTAACTGATC---T M_mulatta300565 ATAGTTGTCA----------TTCTGTTTC-----TTGTAACTCATC---T M_mulatta300590 ATGGTCACAG----------TTCTGTTTG-----CTGTAACTGATC---T M_mulatta300738 ACAGTTA----------CTCTTCTGTTAT-----CTGTAACTGATC---T M_murinus300083 GCGGTCA----------CCATTCTGTTTG-----CTATAACCGATC---T M_murinus300124 AGGGTTGCCA----------TTTTGTTCG-----CTGTAACTGATC---T M_murinus300238 ATGGTCAACA----------TTCTGGTTT-----TTGTAACTGATT---T M_murinus300383 ACGGTCGCCG----------TTCTGTTTG-----TTGTAACTGATC---T M_murinus300404 ACGGCTATAGC------CTCTTCTGTTAT-----CTGTAACTAATC---T M_murinus300461 ACAGTTGGTG----------TGCCGTTTA-----CAGTAACTGATCCGCT M_murinus300514 ATGTTTGCCA----------ATCTGTTTG-----CTGTAAAAGATC---T M_domestica300064 ACGGTCGCTG----------TTCTATTTAATT--CTGTAATAGAAC---C M_musculus300610 ACGGTCGCAG----------TTCTGTTTC-----CTGTAACTGATC---T M_musculus300015 ACTGCCA----------TGGTTCCGTTTA-----CTGTAACACATC---T O_cuniculus300329 ATGGCTGCCT----------TTCT----------CTATAACTGATC---T O_cuniculus300388 ACGGTCACCG----------TTCTGTTTG-----CTGTAACCGATC---T O_cuniculus300489 GTGGCTA----------CTCTTCTGTTAT-----CTGTAACCAATC---T O_garnettii300045 ATGGTCACTG----------TTCTTTTTG-----CTGTAACTGATA---T O_garnettii300198 ACAGTCCCGG----------TTCTGTTTG-----CTATAACCGATC---T O_garnettii300348 ATGGCTGCCG----------TTCTGTTTG-----TGGCTACTGATC---T O_garnettii300375 ACAGTTGCCG----------TTCTGTTTA-----CTGTAACTGATC---T O_garnettii300469 ATGGTCGCCA----------TTCTGTTTG-----CTGTCACTGATC---T O_garnettii300518 ACGGTCGCCG----------TTCTGTTTG-----CTGTAACTGATC---T O_garnettii300589 GCAGG-AACT----------CTCTGCTTG-----CCATAATGGATC---T O_garnettii300663 ACAGGCA----------TTGTTCTGTTAG-----CTGT-----------T O_garnettii300747 ATGGTTGCCG----------TTGTGTTTG-----CTGTGACTGATC---T P_troglodytes300043 ACCATCA----------CCATTCTGTTTG-----CTATAAGTGATC---T P_troglodytes300514 ACGGTCGCCG----------TTCTGTTTG-----TTGTAACTGATC---T P_troglodytes300536 ATGGTCGTAG----------TTCTGTTTG-----CTGTAACTGATC---T P_troglodytes300739 ACAGTTA----------CTCTTCTGTTAT-----CTGTAACTGATC---T P_pygmaeus300027 ACCATCA----------CCATTCTGTTTG-----CTATAACTGATC---T P_pygmaeus300583 ATGGTCATAG----------TTCTGTTTG-----CTGTAACTGATC---T P_pygmaeus300604 ACGGTCGCCG----------TTCTGTTTG-----TTGTAACTGATC---T P_pygmaeus300714 ACAGTTA----------CTCTTCTGTTAT-----CTATAACTGATC---T R_norvegicus300057 ACTGTCA----------TGGTTCCATTTG-----CAGTAACACATC---T S_cerevisiae300062 ATTATATCAGAGGGCATATCATTGAATTTCCGATTTCCAAAGGGAAGAAA S_araneus300120 ATGGTTGTTG----------TTCTGTTTA-----GAGTAGTTGATC---T S_araneus300399 ATGGTCACTGATGGCTTTCGTTCAGTTTC-----TAGTAACTGAT----T S_araneus300461 ACGGTCGCCG----------TTCTGTTTG-----TAGTAACTGATC---T S_araneus300518 A-GGTCCCTG----------GACTATTTC-----TTGTAAGTAACC---T S_tridecemlineatus300186 ACGGTCGCCG----------TTCTGTTTG-----CTGTAACTGATC---T T_nigroviridis300177 ACGGTCGCTG----------TTCAGTTTTA----AAGTAACTGCTTC--A T_belangeri300006 ACGGTCGCCT----------TTCGGGTTTG----CTGTAGCAGGTC---T T_belangeri300015 ACAGTCGCCG----------TCCCACCTG-----CCGTGGCCGGTC---T T_belangeri300038 ACAGTCGCCG----------TCCGGCCTG-----CCGTGGCCGGTC---T T_belangeri300071 AGGGTCGCCG----------TCAGGCCTG-----CCTTGGCAGGTC---T T_belangeri300135 GTGGTCGCTG----------TTCTGCTTG-------GTGGCCGGTC---T T_belangeri300232 AAGGTCACTG----------TTTGGTTTG-----CGATAGCTGATC---T T_belangeri300277 ACTGCCGCCA----------TTGGGCTTG-----CTATGGCCGGTC---T T_belangeri300411 ACCGTCACCG----------TCCGGCCTGGCCTGCCGTGGCTGGTC---T C_familiaris300071 GCAAC----ATTTCAGG---AAAAGACAGTT------------------- C_familiaris300296 ATGAC----ATGTTGG----AAAACACAGCT------------------- C_porcellus300146 GCAAC----ATTTTGGG---GAAAGACAGTT------------------- C_porcellus300395 GCAGC----ATTTTGGG---GAAAGACAGTT------------------- C_porcellus300728 GCAAC----ATTTTGGA---GAAAAGACAGTT------------------ C_porcellus300782 GCAAC----ATTTTGGG---GAGAGAGCCAC------------------- C_porcellus300865 GCAAC----ATTCTGGG---GAAAGACAGTT------------------- D_rerio300264 GCAAC----ATTTAGGA---AAAGGACAATT------------------- D_rerio300265 GCAAC----ATTAAGGA---AAAGGACAACT------------------- D_novemcinctus300058 GCAGT----ATTTCAAG---AAAAGACAACT------------------- D_novemcinctus300326 GCAACA----TTTCGGA---AAAAGACAGTT------------------- D_novemcinctus300328 GCAACAA---TTTCAGG---AAAAGAAGTTT------------------- D_novemcinctus300367 GCAACA----TTTTGGG---AAAAGACAGTT------------------- D_novemcinctus300391 GCAAA----GTTTCGGA---AAAGGAGAGTT------------------- D_novemcinctus300468 GCAACG---ATTTCGGG---AAAAGACAGTT------------------- D_novemcinctus300469 CCAGA----AGAGAAGGG--AGAAACCAGCA------------------- D_novemcinctus300489 --AACA----TTTCAGG---AAAAGCCAGTT------------------- D_novemcinctus300505 GCAACA----TTTAGGG---AAAAGACAGTT------------------- D_melanogaster300107 GTAACT----TTTACGTG--CAATTACAAAA------------------- D_melanogaster300108 GTAACT----TTTACGTG--CAATTACAATG------------------- D_melanogaster300109 GTAACT----TTTACGTG--CAATGACAGTC------------------- E_telfairi300054 GCAAC----ATTTCGGG---AAAAGACATTG------------------- E_telfairi300108 GCTAC----ATTTCAGG---AAAAGAAATTC------------------- E_telfairi300394 GCAGC----ATTTCAGG---AAAAGACATTG------------------- E_telfairi300617 GGAAAAGACATTTCAGG---AAAAGACATTC------------------- E_telfairi300643 GCAAC----ATTTCAGG---AAAAGACATTT------------------- E_telfairi300711 GCAAC----ATTTCAGG---AAAGACTATT-------------------- E_telfairi300713 GCAAC----ATTTCAGG---AAAAGACATTT------------------- E_caballus300001 GCAAC----ATTTCAGG---AAAAGACAATT------------------- E_caballus300139 ATGAC----ATTTTGGG---AAAACACAGCG------------------- E_europaeus300287 GAAAC----ATTTCAGG---AAAAGACAGTT------------------- E_europaeus300344 GCAAC----ATTTTAGG---AAAAGACAATT------------------- E_europaeus300423 GCAAC----ATTTCAGG---AAAAGACAGTT------------------- H_sapiens300654 GCAAC----ATTTTGGG---AAAATACAGTT------------------- H_sapiens300677 GCAAG----ATTTTGGG---AAAATACCATT------------------- L_africana300204 GTGAC----ATTTTGGG---AAAAGACAGCT------------------- M_mulatta300128 GTAAC----ATTTTGGG---AAAATACAGTT------------------- M_mulatta300217 GCAAC----ATTTTGGG---AAAATACAGTT------------------- M_mulatta300565 GCAAC----ATTTTGGG---AAGATACAGTT------------------- M_mulatta300590 GCAAC----ATTTTGGG---AAAATATAGTT------------------- M_mulatta300738 ATGAC----ATTTTGGG---AAAAGACAGCC------------------- M_murinus300083 ATGAT----GTTTTGGG---AAAATACAGTT------------------- M_murinus300124 GCAACA----TTTCGGG---AAAATACAGTT------------------- M_murinus300238 GCAAC----ATTTTGGG---AAAGTACAGTT------------------- M_murinus300383 GCAAC----ATTTTGGG---AAAATACAGTT------------------- M_murinus300404 ACAAC----ATTTTGGG---AAAAGATAGCT------------------- M_murinus300461 GCAAC----ATTTTGGG---AAAATACAGTT------------------- M_murinus300514 GTAAC----ATTTTAGG---AATATATCAAA------------------- M_domestica300064 GCAAC----ATTGTGGG---AAAAGACAAGC------------------- M_musculus300610 GCAAC----ATTGTGGA---AAATGACAGCT------------------- M_musculus300015 --AAG----ATTCTAGG---GAAAGACAGGT------------------- O_cuniculus300329 GCAACA----TGTCAGG---AAAAGACAGTC------------------- O_cuniculus300388 GCAAC----ATTTCAGG---AAAAGACAGTC------------------- O_cuniculus300489 GTGAC----ATTCTGGG---GAAAGAGAGCT------------------- O_garnettii300045 GCAGC----ATTTTAGG---GAAACACAGTT------------------- O_garnettii300198 CCAAC----ATTTTAGG---AAAATGCAGTT------------------- O_garnettii300348 GCAAC----ATTTTGGGG--AAAATACAGT-------------------- O_garnettii300375 GCAAC----ATTTTGGG---AAAATACAGTT------------------- O_garnettii300469 GCAAC----ATTTTGGG---AAAACACAGTG------------------- O_garnettii300518 GCAAC----ATTTTGGG---AAAATACAGTT------------------- O_garnettii300589 GCAGT----ATTTTGAG---GAAACACTGTT------------------- O_garnettii300663 ATAAC----ATTTTGGG---AAAATACAGTT------------------- O_garnettii300747 GCAGC----ATTTTGGG---AAAATACAGTT------------------- P_troglodytes300043 GTAAC----ATTTTGCG---AAAATACAGTT------------------- P_troglodytes300514 GCAAC----ATTTTGGG---AAAATACAGTT------------------- P_troglodytes300536 GCAAG----ATTTTGGG---AAAATATCGTT------------------- P_troglodytes300739 ATGAC----ATTTTGGG---AAAAGACAGCC------------------- P_pygmaeus300027 GTAAC----ATTTTGCA---AAAATACAGTT------------------- P_pygmaeus300583 GCAAC----ATTTTGGG---AAAATATCGTT------------------- P_pygmaeus300604 GCAAC----ATTTTGGG---AAAATACAGTT------------------- P_pygmaeus300714 ATGAC----ATTTTGGG---AAAAGACAGCC------------------- R_norvegicus300057 GTAAG----ATTTTGAG---AAAAGACAGTT------------------- S_cerevisiae300062 ATAAATAAAGTTGTGCTATTTCCATGCATCCTTTTTTCTTTCATTCAATG S_araneus300120 GCAGC----ATTTTGGG---AAAAGACGGTC------------------- S_araneus300399 GCAGC----ATTTCAGG---AGAAGACAGGT------------------- S_araneus300461 GCAAC----ATTTCGGG---AAAAGACAGTT------------------- S_araneus300518 GAGAC----ACCTCAGG---AAAAGACAGCA------------------- S_tridecemlineatus300186 GCAAC----ATTTTGGG---AAAAGACAACT------------------- T_nigroviridis300177 GCAAC----ATCTAGGG---GAAGGACACCT------------------- T_belangeri300006 GCAAC----ATTGCAGG---GAAAGACAGCC------------------- T_belangeri300015 GCAAC----ATTGTGGG---GAAAGACAGCC------------------- T_belangeri300038 GCAAC----ATTGTGGG---GAAAGACAGCC------------------- T_belangeri300071 GCAAC----ATTGTGGG---GAAAGACAGCT------------------- T_belangeri300135 ACAGC----ATTGTGGG---GAAAGACAGGC------------------- T_belangeri300232 GTAAC----ATTGAGGG---TAAAGACAGAA------------------- T_belangeri300277 GCAAC----ATTGTGGG---GAAAGTGCCAT------------------- T_belangeri300411 GCAAC----ATTGTGGG---GAAAGACAGCC------------------- C_familiaris300071 -------- C_familiaris300296 -------- C_porcellus300146 -------- C_porcellus300395 -------- C_porcellus300728 -------- C_porcellus300782 -------- C_porcellus300865 -------- D_rerio300264 -------- D_rerio300265 -------- D_novemcinctus300058 -------- D_novemcinctus300326 -------- D_novemcinctus300328 -------- D_novemcinctus300367 -------- D_novemcinctus300391 -------- D_novemcinctus300468 -------- D_novemcinctus300469 -------- D_novemcinctus300489 -------- D_novemcinctus300505 -------- D_melanogaster300107 -------- D_melanogaster300108 -------- D_melanogaster300109 -------- E_telfairi300054 -------- E_telfairi300108 -------- E_telfairi300394 -------- E_telfairi300617 -------- E_telfairi300643 -------- E_telfairi300711 -------- E_telfairi300713 -------- E_caballus300001 -------- E_caballus300139 -------- E_europaeus300287 -------- E_europaeus300344 -------- E_europaeus300423 -------- H_sapiens300654 -------- H_sapiens300677 -------- L_africana300204 -------- M_mulatta300128 -------- M_mulatta300217 -------- M_mulatta300565 -------- M_mulatta300590 -------- M_mulatta300738 -------- M_murinus300083 -------- M_murinus300124 -------- M_murinus300238 -------- M_murinus300383 -------- M_murinus300404 -------- M_murinus300461 -------- M_murinus300514 -------- M_domestica300064 -------- M_musculus300610 -------- M_musculus300015 -------- O_cuniculus300329 -------- O_cuniculus300388 -------- O_cuniculus300489 -------- O_garnettii300045 -------- O_garnettii300198 -------- O_garnettii300348 -------- O_garnettii300375 -------- O_garnettii300469 -------- O_garnettii300518 -------- O_garnettii300589 -------- O_garnettii300663 -------- O_garnettii300747 -------- P_troglodytes300043 -------- P_troglodytes300514 -------- P_troglodytes300536 -------- P_troglodytes300739 -------- P_pygmaeus300027 -------- P_pygmaeus300583 -------- P_pygmaeus300604 -------- P_pygmaeus300714 -------- R_norvegicus300057 -------- S_cerevisiae300062 ACACATAC S_araneus300120 -------- S_araneus300399 -------- S_araneus300461 -------- S_araneus300518 -------- S_tridecemlineatus300186 -------- T_nigroviridis300177 -------- T_belangeri300006 -------- T_belangeri300015 -------- T_belangeri300038 -------- T_belangeri300071 -------- T_belangeri300135 -------- T_belangeri300232 -------- T_belangeri300277 -------- T_belangeri300411 --------

Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved