snOPY snoRNA Orthological Gene Database
Tetraodon_nigroviridis SCARNA6
sequence
GGTTGGTGATGAGCAGTAAAAGGTCTGATTTCCCACAATCCCCCGCTGCCACGCGGCTC
CCAGCGGCTCCTGCCCGCGTCCATCCTGTTGAAGAGGAGGAGCAGCGATGGCGTCAGGAG
CCGCTGACAGGAGGGATGCGGCCTCGCCCGGCCTGTAGCGAGCCTCCTACAGGCTGCTGG
TCCACATCCGACAGAAGCAGCCAGGGTGGAGCGTCGGGCTGACGGGTGGAGCAGGGAGCT
GATCTCAAGTTTTCAAGCTGAGACC
  Box motif
  Complementary to target RNA
length 264
organism Tetraodon_nigroviridis
snoRNA name SCARNA6
alias
chromosome ⁄ contig Un
locus ⁄ host gene atg16l1
organization Intronic
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved