snOPY snoRNA Orthological Gene Database

Family: SCARNA6

CLUSTAL 2.0.10 multiple sequence alignment H_sapiens300785 GGTCAATGATGAATG-GTAAAAGGTCTGAGTCCTCAGATCCCCTCCCGGCATCCCAGTTA O_anatinus302276 GCTCAGTAAATACTA-TTGAATGAAATCACAGTCCCTTTATTGCTCTT--ATA---ACTC O_anatinus302945 GGTCAGTGATGAATA-GTAAAAGGTCTGACTGGCCAGAGACTGCGCTTTCATCA--CCAT O_anatinus303148 -------GGCTCCTA-TTGAATGAAAG-ACAGTCCCTTTATTGCTCTT--AGGG--ACTC T_nigroviridis300178 GGTTGGTGATGAGCA-GTAAAAGGTCTGATTTCCCACAATCCCCCGCTGCCACGCGGCTC T_nigroviridis300179 GGTCTGTGATGTGGATGTAAAAGGTCTGAGGTTC---AGGCTCCTCCCCCGGCGCCCCTC * ** * * H_sapiens300785 TCCCCAGCTGCCTCTC---CTCCATCGCACTTCAGAAGTGCTGCGA---TGGGCA-GAAG O_anatinus302276 CCAGCAGCTCCTCCGT-----TGCCCATTAGGCTCAGGTTGTTTGGTAATTGGGTGCTGG O_anatinus302945 CCTGATTCCCTGCAGCCTCTTTTTCCATCAGACCCCAGTAGTGCTCTGATTG-GCGGAGG O_anatinus303148 CCAGCAGCTCCTCCGTGAAAATCTCTCAAAGAGTGAGGTTGTTTGGTATTTGTGTGCTGG T_nigroviridis300178 CCAGCGGCTCCTGCCCG-CGTCCATCCTGTTGAAGAGGAGGAGCAGCGATGGCGT-CAGG T_nigroviridis300179 CCAGCAGCCCCTGCTC--CGACCCCGGCGCTCCAGCGTGCGTGTGG-----GCGC-CAGC * * * H_sapiens300785 GGCAGCTGACACTCCGTGATGTCCCTCATTCT-GTGTTCCTCCGTGAGCTCAG----GGA O_anatinus302276 GGCTGCTCATAGCTTGTGATGCACTCAGGCTGGGATATCCAAAGAGGAATGGA-GAGACA O_anatinus302945 AACTGCTGAAATTGTGCGATGTCTTCTACTTTTGTGTTCGCCGGAGTTCCGGGCGACACA O_anatinus303148 TGTTGCGCATAGCTTGTGATGCACTCAGGCTGGGATAGCGAGAGAGGAATGGA-GAGACA T_nigroviridis300178 AGCCGCTGACAGGA-GGGATGCGGCCTCGCCC-G-GCCTGTAGCGAGCCTCCT----ACA T_nigroviridis300179 GGCTGCTGACAGAGCAGGATGTGACCTCAC---G-GCCCCTCAGAGACTTG------GCG ** * * **** * H_sapiens300785 AGACACTGGTTGGCATCCAACAGCTTAGTCACAAAGGGATTTGATTGTTGGGAGTGCTGG O_anatinus302276 ACCGCCCCTTGAGCATCCAACAAAATTAATCACAAAGGAGGTAT--TAATGGGGCCGTGA O_anatinus302945 GCAGTTGGGTAGGCGTCCAACAGGAGCAGTCGTAAAGGAGTTTCGGTGGTGGAAGTTTGG O_anatinus303148 ACCGCCCCTTGAGCATCCAACAAAATTAATCACAAAGGAGGTAT--TATTGGGGCCGTGA T_nigroviridis300178 GGCTGCTGGTCCACATCCGACAGAAGCAGCCAGGGTGGAGCGTCGGGCTGACGGG--TGG T_nigroviridis300179 GGTGGCGTGACGCCAGCGTCCAACAGCATCCGAGCAGGAG----GAGCTGGGGGG--CGG * * ** *** * H_sapiens300785 TATCTGTGGCTAT----GATCTGCCTTGTTCAAGCTGAGACCT O_anatinus302276 GGACTGTGGTCGTACATGATTCTAAGTTTTCAAGCTGAGATC- O_anatinus302945 AGGTCTTGGTTGT----GATCTGAAGTTTTCAAGCTGAGACC- O_anatinus303148 GGACTGTGGTCGTACATGATTCTAAGTTTTCAAGCTGAAATC- T_nigroviridis300178 AGCAGG-GA-GCT----GATCTCAAGTTTTCAAGCTGAGACC- T_nigroviridis300179 AGCCTG-AACGCT----GATCT--GTCCTTCCTGCTGAGACC- * *** *** ***** * *

Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved