snOPY snoRNA Orthological Gene Database
Tetraodon_nigroviridis SNORA21
sequence
CCCCTTCCAAAAGCACTTGCTCGGTCCCCTCAGTGGCTGGGTGAGTTGTCGACGAAGGG
CACATTGACGTCGTCACTGTGGGTGAGACGGCAGCGCCTGGCTGTGGCTGACTGGTCTCA
ATCAGTGGGGAGACAAGC
  Box motif
  Complementary to target RNA
length 137
organism Tetraodon_nigroviridis
snoRNA name SNORA21
alias
chromosome ⁄ contig Un
locus ⁄ host gene rpl23
organization Intronic
target RNA 28S rRNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved