snOPY snoRNA Orthological Gene Database
Tetraodon_nigroviridis
28S rRNA
CAAE01000041, CAAE01000327
1317
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
cgcccctcctcctcccccccccttcccggggcgggggggcgcgaaggggtccggggcgcg
gtccgccgggggcgcggtcccgccggccgggccgcctcggctggcgcctagcagccgact
tagaactggtgcggaccgggggaatccgactgtttaattaaaacaaagcatcgcgaaggc
ccgcggcgggtgttgacgcgatgtgatttctgcccagtgctctgaatgtcaaagtgaaga
aattcaatgaagcgcgggtaaacggcgggagtaactatgactctcttaaggtagccaaat
gcctcgtcatctaattagtgacgcgcatgaatggatgaacgagattcccactgtccctac
ctaccgtccagcgaaaccacagccaagggaacgggcttggcggaatcagcggggaaagaa
gaccctgtgaggttgactctagtctggcactgtgaagagacatgagaggtgtagaataag
tgggaggccccggccgcggttgaaataccactactcttaccgttttttcacttacccgct
gaggcggggaggcgagccccccagcgggctctcgcttctggcgtcaagcgcccggcccgg
ccgggcgcgacccgctgcggggacagtggcaggtggggagtttgactgggacggtacacc
tgtcaaacggtaacgcaggtgtcctaaggcgagctcagggaggacagaaacctcccgtgg
agcagaagggcaaaagctcgcttgatcttgattttcagtacgaatacagaccgtgaaagc
ggggcctcacgatccttctgactttttgggttttaagcaggaggtgtcagaaaagttacc
acagggataactggcttgtggcggccaagcgttcatagcgacgtcgctttttgatccttc
gatgtcggctcttcctatcattgtgaagcagaattcaccaagcgttggattgttcaccca
ctaatagggaacgtgagctgggtttagaccgtcgtgagacaggttagttttaccctactg
atgatgtgttgctgcaacagtaatcctgctcagtacgagaggaaccgcaggttcggacat
ttggtgcgtgtgcttggctgaggagccaatggtgcgaagctaccacccgtgggattatga
ctgaacgcctctaagtcagaatcccgcctagacgcagcgataccatagcgccgcggannn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
SNORA74 H/ACA
SNORD37 C/D
SNORD47 C/D
snosnR60_Z15 C/D
SNORD77 C/D
SNORD79 C/D
SNORD75 C/D
SNORD74 C/D
SNORA30 H/ACA
SNORA23 H/ACA
ACA64 H/ACA
ACA64 H/ACA
SNORD51 C/D
SNORD35 C/D
SNORD35 C/D
SNORD35 C/D
SNORD88 C/D
SNORD88 C/D
SNORD88 C/D
SNORA54 H/ACA
SNORD58 C/D
SNORD58 C/D
SNORD58 C/D
SNORD24 C/D
SNORD72 C/D
SNORD72 C/D
snoMBII-202 C/D
snoMBII-202 C/D
SNORA65 H/ACA
SNORA65 H/ACA
SNORD12 C/D
SNORD12 C/D
SNORD12 C/D
SNORA27 H/ACA
SNORD49 C/D
SNORD49 C/D
SNORA22 H/ACA
SNORA22 H/ACA
SNORD111 C/D
SNORD111 C/D
SNORA63 H/ACA
SNORA63 H/ACA
SNORA26 H/ACA
SNORA47 H/ACA
snoU13 C/D
SNORD18 C/D
SNORD18 C/D
SNORA19 H/ACA
SNORA33 H/ACA
SNORD2 C/D
SNORD21 C/D
SNORD60 C/D
SNORD60 C/D
SNORD60 C/D
SNORD60 C/D
SNORA9 H/ACA
SNORA9 H/ACA
U8 C/D
SNORA3 H/ACA
SNORA3 H/ACA
SNORD26 C/D
SNORD29 C/D
SNORD30 C/D
SNORD31 C/D
SNORD31 C/D
SNORA21 H/ACA
SNORA21 H/ACA
SNORD49 C/D
SNORA17 H/ACA
SNORD15 C/D
SNORD15 C/D
SNORD46 C/D
snosnR61 C/D
SNORA68 H/ACA
SNORD2 C/D
SNORD2 C/D
SNORD111 C/D
SNORA8 H/ACA
SNORD99 C/D
snopsi28S-3327 H/ACA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved