snOPY snoRNA Orthological Gene Database
Tetraodon_nigroviridis SNORA9
sequence
GTGCAGGCTTTTGCAGCGAGGCCCAGCCTGATGTGGCTGCGTCCTCCCCTCCCAGCTCT
GCCAGAGTCAAGCGGGGCCGTTTGAGGCTCTGCTGTGGTTCTCCACACCAGGGTTATAGG
TTCGCCTCCAACACCA
  Box motif
  Complementary to target RNA
length 135
organism Tetraodon_nigroviridis
snoRNA name SNORA9
alias
chromosome ⁄ contig 21_random
locus ⁄ host gene Poly:SNORA9
organization Poly
target RNA 28S rRNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved