snOPY snoRNA Orthological Gene Database
Tetraodon_nigroviridis SNORD60
sequence
AGCCCCTGATGACAGGTTAAACAACTTTTCTGACACCTCGTATGAGAGCTGCCCTGCAG
CTCCTGATTCCAAACCTGATCTGAGGCTC
  Box motif
  Complementary to target RNA
length 88
organism Tetraodon_nigroviridis
snoRNA name SNORD60
alias
chromosome ⁄ contig 18
locus ⁄ host gene eif3bb
organization Intronic
target RNA 28S rRNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved