snOPY snoRNA Orthological Gene Database
Tetraodon_nigroviridis SNORD2
sequence
GAGTGATGTGATGCTTAACCATCTTTCGGGACTTACCCATTAATGGGGATACTTTTTTA
TTTTCACTGATCACTC
  Box motif
  Complementary to target RNA
length 75
organism Tetraodon_nigroviridis
snoRNA name SNORD2
alias
chromosome ⁄ contig 15
locus ⁄ host gene eif4a2
organization Intronic
target RNA 28S rRNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved