snOPY snoRNA Orthological Gene Database
Tetraodon_nigroviridis snoZ30
sequence
CTGCGAGGATGACTGTTGATACGACTGACCTGGCAGTGCCGGCCTCCGGGTCAGCTCTG
GCCAGGAAATGACACCTGTTAATCTTCTCTCTGAGCAG
  Box motif
  Complementary to target RNA
length 97
organism Tetraodon_nigroviridis
snoRNA name snoZ30
alias
chromosome ⁄ contig 13
locus ⁄ host gene kif23
organization Intronic
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved