snOPY snoRNA Orthological Gene Database

Family: SNORD7

CLUSTAL 2.0.10 multiple sequence alignment D_rerio300101 CTGTGCTGATGAGCTGTGATTGTGTCTGACCTGGTATTGCTGTTCCTCCGGGAGTAACTC D_melanogaster300147 AGCCAATGATGA--TTAAACCACAAATG-CAGGGAGTGGGCAG----CTGGCAACAG--T H_sapiens300437 ATGCGATGATGA-GTGAAGTAGAGCCTGACCTGGTATTGCCATTGCTTCACTGTTGGCTT M_musculus300317 ATGCAATGATGA-GCGAAGTATAGTCTGACCTGGTATTGCCATTGCTTTGGCGCTGGCTC T_nigroviridis300084 CTGCGAGGATGA-CTGTTGATACGACTGACCTGGCAGTGCCGG-CCTCCGGGT-CAGCTC ***** ** * ** * D_rerio300101 TGACCAGGGTCTGAAGA-CTGT-AATCTTCTCTCTGAGCAG D_melanogaster300147 TGGCGCACGCATGACCAGCAACTAATCTTCTCGCTGA-CGG H_sapiens300437 TGACCAGGGTATGAT---CTCTTAATCTTCTCTCTGAGCTG M_musculus300317 TGACCAGGGTGTGAC---CCCTTAATCTTCTCTCTGAGCTG T_nigroviridis300084 TGGCCAGGAAATGACAC-CTGTTAATCTTCTCTCTGAGCAG ** * *** * ********* **** * *

Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved