snOPY snoRNA Orthological Gene Database
Tetraodon_nigroviridis SNORD18
sequence
CGCCTATGATGATGTTCCACTTCTGGTCCGTGTTTCTGAGTCCTGATTGTTACGGAAGT
TCTGAGCAA
  Box motif
  Complementary to target RNA
length 68
organism Tetraodon_nigroviridis
snoRNA name SNORD18
alias
chromosome ⁄ contig 13
locus ⁄ host gene rpl4
organization Intronic
target RNA 28S rRNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved