snOPY snoRNA Orthological Gene Database
Tetraodon_nigroviridis SNORD49
sequence
GTCAATGATGAAAACTAATAGGAAGTGCCGTCTGATGCGATAACTGACGATGTTTAATA
TTCACCGTTC
  Box motif
  Complementary to target RNA
length 69
organism Tetraodon_nigroviridis
snoRNA name SNORD49
alias
chromosome ⁄ contig 7
locus ⁄ host gene Poly:SNORD65
organization Poly
target RNA 28S rRNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved