snOPY snoRNA Orthological Gene Database
Tetraodon_nigroviridis snoMBII-202
sequence
TGATGACAAATCTCCGGAATCTCTGTATTGACTTGATGAATACTTGAACCCATTAATCT
GATACTGGCTGCATCGAT
  Box motif
  Complementary to target RNA
length 77
organism Tetraodon_nigroviridis
snoRNA name snoMBII-202
alias
chromosome ⁄ contig 5
locus ⁄ host gene rpl13
organization Intronic
target RNA 18S rRNA, 28S rRNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved