snOPY snoRNA Orthological Gene Database
Tetraodon_nigroviridis SNORD72
sequence
GTCTTGTCAGTGATGTTAATCATAAATGTCCGAACATATGACTTATTGTGATTCATTTC
AATGCACTGAGACAAGAC
  Box motif
  Complementary to target RNA
length 77
organism Tetraodon_nigroviridis
snoRNA name SNORD72
alias
chromosome ⁄ contig 4
locus ⁄ host gene rpl37
organization Intronic
target RNA 28S rRNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved