snOPY snoRNA Orthological Gene Database
Tetraodon_nigroviridis ACA64
sequence
TCAGACTGAAAATGAGCTCAGATGTCGCGCTGGTCTGAGGTCAGATACCTGAGCCTAAA
GTATATTGGTGCATTTAGCTTATCAGCTGCTCACCTGTTGGCAGCGTGATAAAACCCATG
TTCCTACAAAA
  Box motif
  Complementary to target RNA
length 130
organism Tetraodon_nigroviridis
snoRNA name ACA64
alias
chromosome ⁄ contig 2
locus ⁄ host gene nifk
organization Intronic
target RNA 28S rRNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved