snOPY snoRNA Orthological Gene Database
Tetraodon_nigroviridis SNORD37
sequence
GCAAATGATGAGTTAAAACATTCTTCACTTTGACCTGATTGACAGGTGATGATAAATTT
GACTGAAC
  Box motif
  Complementary to target RNA
length 67
organism Tetraodon_nigroviridis
snoRNA name SNORD37
alias
chromosome ⁄ contig 1
locus ⁄ host gene eef2a.2
organization Intronic
target RNA 28S rRNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved