snOPY snoRNA Orthological Gene Database
Spermophilus_tridecemlineatus SNORD14
sequence
TCGCTGTGATGATGGATTCCAAAACCATTCGTAGTTTCCACCAGAAATTTTGTGTTGGC
TAGTTCCTTCCTTGGATGTCTGAGCGA
  Box motif
  Complementary to target RNA
length 86
organism Spermophilus_tridecemlineatus
snoRNA name SNORD14
alias
chromosome ⁄ contig GeneScaffold_1420
locus ⁄ host gene HSPA8
organization Intronic
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved