snOPY snoRNA Orthological Gene Database

Family: SNORD14

CLUSTAL 2.0.10 multiple sequence alignment C_elegans300129 ------------------GCTTCTGTGATCG-ACAACAAACCCAGCTCTCTGAATGATTG S_cerevisiae300036 GTTTATGATGAGACCACGTCCTTAGTGACAATGCTATAAACCCAGCTCTTCGATTCGTTT * * **** * * ************ ** * ** C_elegans300129 TGAGGTTAAGAAAACAG------CTGAGAAGC--------- S_cerevisiae300036 TTAATGAAAGGGAGAAGATTTTTTTGTCAAACGCTCTGAGT * * *** * ** ** ** *

Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved