snOPY snoRNA Orthological Gene Database
Spermophilus_tridecemlineatus SNORA19
sequence
ATGCACATTTCATTGACCTGCTTTCCTTTGTATATGTGAGCAGTGTTATTTCTTATGTG
CTACACAAATAGTTGAAGGTTAATTAGCAGAATAACTATAAATAGTAATGCTGCCAGTCT
CCTTTCAGACAAAA
  Box motif
  Complementary to target RNA
length 133
organism Spermophilus_tridecemlineatus
snoRNA name SNORA19
alias
chromosome ⁄ contig GeneScaffold_1300
locus ⁄ host gene ENSSTOG00000002512
organization Intronic
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved