snOPY snoRNA Orthological Gene Database

Family: SNORA19

CLUSTAL 2.0.10 multiple sequence alignment C_familiaris300070 ---------TTGCACAAAGAAAGGAGAGGATAAAAGAGAGAA-CCAGTAT C_familiaris300338 -------------GTGCACATTT-TGTTGACCTGCTTTCTCTTGCGTAT- C_familiaris300354 -------------GTGCACATTT-CATTGACCTGC-TTTTCTTGTATA-- C_porcellus300965 -------------GTGCACATTT-TGTTGACCTGCTTTCTCTTGCGTAT- C_porcellus301039 -------------ATGCACATTT-CATTGACCTGCTTTCTTTCATATA-- D_rerio300227 -------------GTGCACATTT-CATTGTCCCATTC-TTCC-CATGTA- D_novemcinctus300068 -------------TAGCACATTT-CATTGACTTGCTTTCTTTTG----T- D_novemcinctus300562 -------------TTGCACATTT-CATTGACCTGCTTTCTTTTG----T- D_melanogaster300174 ------------------------CGTGCACTTAATTAGGTATCTCTGCC E_telfairi300470 -------------GTGCACATTT-CATCGACGTGCTACCATTT--GTAT- E_telfairi300812 -------------GTGCACATTT-CATTGACCTGCTTCCATTT--ATAT- E_telfairi300868 -------------GTGCACATTT-CATTGACCTGCTTCCATTT--ATAT- E_caballus300355 -------------GTGCACATTT-CATTGACCTGCTTTCTCTCGTATAT- E_europaeus300141 -------------GTGCACATTT-CATTGATCCACTTACTTCTGTTTGT- E_europaeus300161 -------------------------------------------------- E_europaeus300263 -------------GTGCACATTT-CACTGGCCCGCTTTCTTCTGTTTGT- E_europaeus300498 ------------------------------------CAGGACAAATTATT E_europaeus300516 -------------GTGCACATTT-CATTGACCTGCTTTCTTCTATCTGT- E_europaeus300607 -------------GTGCACATTT-CATTGACCTGCTTTCTTCTGCTGGT- E_europaeus300670 -------------GTGCACGTTT-CATTGACTTGCTTTCTTCTGTTTGT- E_europaeus300713 -------------GTGCACCTTT-TATTGACATGCTATTTTCTGTTTGT- F_catus300044 -------------GTGCACATTT-CATTACCCCGTGTTCTCTTGTATA-- F_catus300320 -------------ATGCACATTT-CATTGACCTGCTTTCTTTTGTATA-- G_gallus300094 -------------ATGCACATTT-CATTGACCTGCTTTCATTGCAAGTG- H_sapiens300474 -------------GTGCACATTT-CATTGACCTGCTTTCTTTT----A-- L_africana300050 ---------GCGCA---CATTTCTT--TGGCCTACTTCTTT-TACATAT- L_africana300062 GAATATGTTCCTTTCACCTTCTTGCTCTAATGACAACCCAGCTTTCCCTA L_africana300223 -------------------------------------------------T L_africana300378 -------AGACACAATTCAATCCATAACAACCTGTTTTCTTATATATAT- L_africana300460 -------------GTGCACATTT-CACTGACCTGCTTTCTTTTATATTT- M_mulatta300137 -------------GTGCACATGT-CATTGACCTGCTTTCTTCTGTATA-- M_mulatta300138 -------------GGGCACATTT-CATTGTCTTTTTTCTTTATTTCAAG- M_murinus300084 -------------GTGCACATTC-CATTGACCTGCTTTCATTTGTATAT- M_domestica300013 -------------GTGCACATTT-CATTGACCTGCTTTCATTGTTCAAG- M_domestica300108 -------------CTGCACATTT-CATTGACCTGCTTTCGTTGTAT-TG- M_domestica300109 -------------GTGCACGTTT-CATTGACCTGCTTTCATTGTTCACG- M_musculus300364 -------------TTGCACATTT-CATCAACCTGCTTTCTTTTGAATAT- M_musculus300800 -------------TTGCACATTT-CATTGACCTGCTTTCTTTTGAAAAT- M_musculus300804 -------------TTGCACATTT-CATTGACCTGCTTTCTTTTGAAAAT- O_anatinus304382 -------------GTGCACATTT-CGTTGACCTGCCTTCT-CTATAATG- O_anatinus304383 -------------GTGCACATTT-CATTGACCTGCTTTCATTGCATTGT- O_anatinus304384 -------------AAGCACATCC-CACTGTCTTTTTTTCTGTTCTGGAG- O_cuniculus300047 -------------TTGCACATTT-TATTGACCTGCTTTCTTTTGCATGT- O_cuniculus300335 -------------CTGCACATTT-CATTGTCCTGCTTTCTTT-GTATGT- O_cuniculus300448 -------------CTGCACATTT-CATTGGCCTGCTTTCTTT-ATATGT- O_garnettii300007 -TATCACAAAGTATTATTCTTCTTTTGATGTTTTTTCAACCATTTAAAAA O_garnettii300014 -------------ATGCACATTT-CATTGACCTGCTTTCTTC---ATA-- O_garnettii300049 -------------GTGCACATTT-CATTGACCTGTTTTCTTT---ATA-- O_garnettii300053 -----------------TCGATAATGTTTCTAAAGTCCTGTCG---TATA O_garnettii300073 ------------------------------------------GTGTAAAA O_garnettii300105 -----------------------------------ATGGTCAACATCAAG O_garnettii300127 -------------------------------------------------- O_garnettii300142 ---AAACACAAGTTCAAGAATAAAATGATTAAGAATTTTCAGGAAATATA O_garnettii300148 -------------------------------AGGTAATAGCATTGAAAGT O_garnettii300163 -------------GAGCACATTT-CATTGACCTGCTTTCTAT---GTG-- O_garnettii300165 ------------------------------TGGCATGAATGGACAAGAAT O_garnettii300202 ----------------------------------ATGAATGGTTATATGT O_garnettii300213 -------------GTGCACATTT-CATTGACCTGCTTTCTTT---ATA-- O_garnettii300252 --------------------TTGATGTTT-TAAAATGCTGCCTGGTTATA O_garnettii300264 -------------GTGCACATTT-CATTGACCTGCTTTCTTT---ATA-- O_garnettii300321 -------------GTACACATTT-CATTGACCTGCTTTCTCT---GTA-- O_garnettii300351 -------------------------------------------------- O_garnettii300365 --------------------ATAACCAGATAGCTGAAATTTTATGAAGAA O_garnettii300373 -------------GTGCACATTT-CATTGACCTGCTTTCTTT---ATA-- O_garnettii300376 ---------------------------------------CTGCAAGAGAA O_garnettii300382 -------------------TTTTATTTTAAAAATAGTTCACCCTTTTGTA O_garnettii300408 -----------------------AGGAACAAAATTGACACCATTGAAAAT O_garnettii300414 --------------------TTGATGTTT-TAAAATGCTGCCTGGTTATA O_garnettii300434 --------TTTCATAAAAAATTCTATTGGTAGCTAAAAAACAA-AACAAA O_garnettii300452 -------------GTGCACATTT-CATTGACCTGCTTTCTTT---ATA-- O_garnettii300461 --------------------AAGTAGAGTGTTAAGATCAGAAGTCCATAT O_garnettii300472 ------------------TTGTCACCATCAGAA-ACTACATCCTTTTATA O_garnettii300507 -------------GTGCACATTT-CATTGACCTGCTTTCTCT---GTA-- O_garnettii300565 -------------------------------------------------- O_garnettii300590 -------------------------------------------------T O_garnettii300674 -------------GTGCACATTT-CATTGACCTGCTTTCTTT---ATA-- O_garnettii300684 -----------------ACATTT-CGTTGACCTGCTTTCTTT---ATA-- O_garnettii300718 ----------------GATCACATTATGACAGAATAGGAAAACAAAAAAA O_garnettii300732 ---------------------------------------CAGCAAGAAAA P_troglodytes300719 -------------GTGCACATTT-CATTGACCTGCTTTCTTTT----A-- P_pygmaeus300669 -------------GTGCACATTT-CATTGACCTGCTTTCTTTTGTTTA-- R_norvegicus300029 ------------------------ATTTAAAA--CAAT----CTAGACTG R_norvegicus300048 ----------------------AATCACAATAACTTAAGAAGTAAAGTGA R_norvegicus300097 -----------------------------------------TAGTAATAA R_norvegicus300120 -------------------------------------------------- R_norvegicus300193 ------------------TTGGT-CATT-ACCTGCTTT--TTTGAATAT- R_norvegicus300255 -------GAGCATACATAAATGACTTTTAAGAACCAATGAGGTTTGACTG R_norvegicus300345 ----------------------------------------ATGGAGATGA R_norvegicus300425 -------------CTGCACATTT-CATTGACCTGCTTTCCTTTGACTGT- R_norvegicus300848 -------------CTGCACATT--CATTGACCTGCTTTCCTTTGACTGT- R_norvegicus300903 -------------TTGCACATCT-TATTGACCTGCTTTCTTTGGAATAT- R_norvegicus300980 -------------CTGCACATTT-CATTGACCTGCTTTCCTTTGACTGT- R_norvegicus301105 -------------CTGCACATTT-CATTGACCTGCTTTCTTTTGAATAT- S_araneus300616 -------------GTGCACATTT-CATTGACCTGTTTTGTAACGTTCTC- S_araneus300997 -------------GTGCACATTT-CATTGACCTGCTTTCTAATGTTCTT- S_araneus301065 -------------GTGCATAATTGCACGGACCTGCTTTCCAGTGTTCTTT S_tridecemlineatus300270 -------------ATGCACATTT-CATTGACCTGCTTTCCTTTGTATA-- T_nigroviridis300089 -------------GGGCACAGTT-CATTGTCCGGCTC-CGCTGTCCGTC- T_belangeri300343 -------------GTGCACATTT-CATTGACCTGCTTCCTATTGTATAA- X_tropicalis300129 -------------CTGCACATTT-CATTGACACACTC-CTAGAATTGTG- C_familiaris300070 GTAAGCA-GTGCTA--TTTCTAATG-TGCTA--CAAAGGGTTGAAGGGTA C_familiaris300338 -GTGAGCAGTGTTA--TTTCTTATG-TGCAGGAGAAATAGTTAAAGGTTA C_familiaris300354 TGTGAGCAGTGTTA--TTTCTTACG-TGCTATACAAATAGTTGAAGGTTA C_porcellus300965 -GTGAGCAGTGTTA--TTTCTTATG-TGCAGGAGAAATAGTTAAAGGTTA C_porcellus301039 TGTGAGCAGTGTTA--TTTCTTATG-TGCTATACAAATATTTGAAGGTTA D_rerio300227 -A-GAACTGAGATA--TTTCTTATG-TGCTAGAT-AAACTCTGGAGGTAA D_novemcinctus300068 -GTGAGCAGTGTTA--TTTCTTATG-TACTATTCAAATAGTTGAAGGGTA D_novemcinctus300562 -GTAAGCAGTGTTA--TTTCTTCTG-TGCTATACAAATAGT-GAAGGTTA D_melanogaster300174 AATCGAGGCTCTGA--TGCTCAGTGAATGTGCGCATAGCAAAGAAGATGT E_telfairi300470 -GTGAGCAGTGTTA--TTTCTTATG-TGCGAATCGAGTAGCTGAAGGTCA E_telfairi300812 -GTGAGCAGTGTTA--TTTCTTATG-TGCTAAACAAGTAGCTGAAGGTTA E_telfairi300868 -GTGAGCAGCGTTA--TTTCTTATG-TGCTAAACAAGTAGTTGAAGGTTA E_caballus300355 -GTGAGCAGTGTTA--TTTCTTATG-TGCTATATAAACAGTTGAAGGTTA E_europaeus300141 -GTGAGCAGTTTAT--TTCTTTATG-TGCTATATAAACAGATGAAGGTTA E_europaeus300161 ---------TACCA--CATCTTATG-TGCTGTACAAATAGATGAAGGTTA E_europaeus300263 -GTGAGCAGTGTTA--TTTCTTCTG-TGCTATACAAATAGATGAAGGTTT E_europaeus300498 TAATAAACAGAAAC--CCTCTTATG-TGCTATACAAATAGCTCAAGGTTA E_europaeus300516 -GTGAGCAGTCTTA--TTTT-TATG-TGCTATACAAACAGATGAAGGTTC E_europaeus300607 -GTTAGCAGTGTTA--TTTCTGATG-TGCTATAGAAATAGCTGAAGGTTA E_europaeus300670 -GGGGGCAGTGCTA--TTTCCTATG-TGCTGTACAAATCGATGAAGCTTC E_europaeus300713 --TGAGCAGTGATA--TTGCTTATG-TGCTGTACAAATAGATGAAGGTTA F_catus300044 TGCGAGCGGTGTTA--TTTCTTGTG-TGCTGTACGGATAGTTGAAGGTTA F_catus300320 TGTGAGCAGTGTTA--TTTCTTATG-TGCTATACAAATAGTTGAAGGCTA G_gallus300094 -ATGAGCAGTGTTA--TTTCTGGTG-TGCTAAAGAAATATTTGAAGGCTA H_sapiens300474 TGTGAGTAGTGTTA--TTTCTTATG-TGCTATACAAATAATTGAAGGCTA L_africana300050 -GTGAGCGGTGTTA--TTTGTTATG-TGCTATGCAAATTTTTTTTGTTTA L_africana300062 TGTGAGCAGTATTA--TTTCTTCTG-TATTCTTCAAGGAGTTGAAGGTTA L_africana300223 TGGAACCAACTCGA--CAGCACCTAATACAATACAAATAGTTGAAGGTTA L_africana300378 -ATGAGCAGCCTTA--TTTCTTATG-TGCCATACAAATACTTGAAAGTTA L_africana300460 -GTGAGCAGTGTTA--TTTCTTTTG-TGCTATACAAATAGTTGAAGGTTA M_mulatta300137 TGTGAGCAGTGTTA--TTTCTTATG-TGCTATACAAATAATTGAAGGCTA M_mulatta300138 -AGGAAAGATA-----TTTCTGATG-TGCTAAACAAACATTTGGAGGTTA M_murinus300084 -GTGAGCAGTACTT--TTTCTGATG-TGTTATACAAATAGTTCAAGGTAA M_domestica300013 -G-GATGAGTGTTAA-TTTTTGATG-TGCTATATAATTTATACATGGTTA M_domestica300108 -T-GAGCAGTGTTA--TTTCTGATG-TGCTATATAATTTGTAGAAGGTTA M_domestica300109 -A-AAGCAGTGTTA--TTTCTGACG-TGCTATACAATTTATAGAAGGTTA M_musculus300364 -GTGAGCAGTGTTG--TTTCTTACG-TGCTATACAAATAGTTGAAAGT-A M_musculus300800 -GTGAGCAGTGTTA--TTTCTTATG-TGCTATACAAATAGTTGAAGGTTA M_musculus300804 -GTGAGCAGTGTTA--TTTCTTATG-TGCTATACAAATAGTTGAAGGTTA O_anatinus304382 -GTGAGCAGTGTTA--TTTCTCATG-TGCAAAACAAATGATTGAAGGTTA O_anatinus304383 -G-GAGCAGTGTTA--TTTCTGATG-TGCTATATAAACTGTTGAAGGTTA O_anatinus304384 -AGGAAAAAAGCAG--TTTCTGTTG-TGCTAGATGAAC--TTGAAGGTAA O_cuniculus300047 -GTGAACAGTGTTA--TTTCTT----CGTTATTCAAAGAGTTGAAGGTTA O_cuniculus300335 -GTGAACAGTATTA--TTTCTTATG-TGCTATACAAAGAGTTGAAGGTTA O_cuniculus300448 -GTGAGCAGTGTTA--TTTCTTATG-TGCTACACAAATAGTTGAAGGTTA O_garnettii300007 TACAAACAC---TA--TTTCTTATG-TGCCATACAAATAGTTGAAGGTTA O_garnettii300014 GGTGAGCGGTGTTA--TTTCTTATG-TGCTACACAAATAGGTGAAGGTTA O_garnettii300049 TGTGAGCAGTGTTA--TTTCTCATG-TGCTATACAGATAGTTGAAGGTTA O_garnettii300053 TGTGAGCAGTGTTA--TTCTTTATG-TGCTATACAAATAGTTGAAGGTTA O_garnettii300073 ATTCCTGAT-------CTTCTTATG-TGCTATACAGATAGTTGAAGGTTA O_garnettii300105 ACTTGAAGT----G--AGTCTTATG-TGCTATACAGATAGTTGAAGGTTA O_garnettii300127 ----------------------ATG-TGCTATACAAATAGTTGAAGGTTA O_garnettii300142 TATGAGCAGTGTTA--TTTCTTATG-TG-TATACAAATAGTTGAAGGTTA O_garnettii300148 TTTTCTCCTCATTA--TTTCTTATG-TGCTGTACAAATAGTTGAAGGTTA O_garnettii300163 AGCA-GTGTTA-----TTTCTCACG-TGCTATACAAATAGTTGAAGGTTA O_garnettii300165 GGAGAAAGGTGTTA--TTTCTTATG-TGCTATACGAATAGTTGAAGATTA O_garnettii300202 GAGCA---GTGTTA--TTTCTTATA-TGCTATGCAAATAGTTGAAGATTA O_garnettii300213 CGTGAGCAGTGTTA--TTTCTTATG-TGCTATACAGACAGTTGAAGGTTA O_garnettii300252 TGTGAGCAGTGTTA--TTTCTTATG-TGCTATACAGATAGTTGAAGGTTA O_garnettii300264 TGTGAGCAGTGTTA--TTTCTTATG-TGCTATCCAAATAGCTGAAAGTTA O_garnettii300321 TGTGAGCAGTGTTC--TTCT----G-TGCTATACAAATAGTTGAAGGTTA O_garnettii300351 -----AAGCTGTTA--TTTCTTACA--GCTATACAAATAGTTGAAGGTTA O_garnettii300365 AATAAGAATT-TAA--TTTCCTATG-TGCTATACAAATAGTTGAAGGTTA O_garnettii300373 TGTG-GTAGTGATTATTTTCTCACG-TGCTATACAAATAGTTGAAGGTTA O_garnettii300376 GTT---TTTTGTTA--TTTCTTATG-TGCTATACGAATATGTGAAGGTTA O_garnettii300382 TGTGAGCAATGTTT--TTTCTTATG-TGCTATACAAATAGTTGAAGGTTA O_garnettii300408 TGTAATCCT---TA--TTTCTTATG-TGCTATACAAATAGTTGAAGGTTA O_garnettii300414 TGTGAGCAGTGTTA--TTTCTTATG-TGCTATACAGATAGTTGAAGGTTA O_garnettii300434 ACCAAGAAG----A--GTTCTTATG-TGCTATACAGATAGTTGAAGGTTA O_garnettii300452 TGTGAGCAGTGTTA--TTTATTACG-TGCTATACAAATAGCTGAAGGTTG O_garnettii300461 GTGAGCA-GTGTTA--TTTCTTATG-TGCTATACAAATAGTTGAAGTTTA O_garnettii300472 TGTGTGCAGTGTTA--TTTTTTATG-TGCT--ACAAATACTTGAAAGTTA O_garnettii300507 TGTGAGCAGTGTTA--TTTCTCACG-TGCTATACAAATAGTTGAAGGTTA O_garnettii300565 ---------------------------AAAAACCGAATAGTTGAAGGTAA O_garnettii300590 TACACAAAA---TA--TAACT--TG-TGCTATCCAAATAGTTGAAGGTTA O_garnettii300674 TGTGAGCAGTGTTA--TTTCTCATG-TGCTATACAGATAGTTGAAGGTTA O_garnettii300684 TGTGAGCAGTGTTA--TTTCTTAT-----TATACCAATAGTGGAAGGTTA O_garnettii300718 CCCAAACCTTGTTA--TTTCTCATG-TGCTATACAGATAGTTGAAGGTTA O_garnettii300732 AATGA-CCTTGTTA--TTTCTCATG-TGCTATACAGATAGTTGAAGGTTA P_troglodytes300719 TGTGAGTAGTGTTA--TTTCTTATG-TGCTATACAAATAATTGAAGGCTA P_pygmaeus300669 TGTGAGTAGTGTTA--TTTCTTATG-TGCTATACAAATAATTGAAGGCTA R_norvegicus300029 TGTGAGCAGTGTTA--TTTCTTATG-TGCTATACAAATAGTTGAAGGTTC R_norvegicus300048 TGTGAGCATTGTAA--TTTCTTATG-TGCTATACAAATAGTGGAAGGTTA R_norvegicus300097 TAATAATAATAATA--ATTCTTATG-TGCTATACAAATAGTTGAAGGTTA R_norvegicus300120 -AAGAAAATATCAT--CCCCTTATG-TGCTATACAAATAGTTGAAGGTTA R_norvegicus300193 -GTGAGCAGTGTTA--TTTCTTATG-AGCTATACAAATAGTTGAAGATTA R_norvegicus300255 TGTGAGCAGTGTTA--TTTCTTATG-TGCTATACTAATAGTTGAAGGTTC R_norvegicus300345 TTAAGATATATATA--TATCTTATG-TGCTATACTAATAGTTGAAGGTTC R_norvegicus300425 -GTGAGCAGTGTTA--ATTCTTATG-TGCTATACTAATAGTTGAAGGTTC R_norvegicus300848 -GGGAGCAGTGTTA--ATTCTTATG-TGCTATACTAATAGTTGAAGGTTC R_norvegicus300903 -GTGAGCAGTGTTA--TTTCTTACG-TGCTATACACATAGTTGAAGGTTA R_norvegicus300980 -GTGAGCAGTGTTA--ATTCTTATG-TGCTATACTAATAGTTGAAGGTTC R_norvegicus301105 -GTGAGCAGTGTTA--TTTCTTATG-TGCTATACAAATAGTTGAAGGTTA S_araneus300616 -GTGAGAAGTGTTA--GTACTCATG-TGCTGCATAAT-AGTTGAAG-CTA S_araneus300997 -GTGAGCAGTGTTA--TTTCTCATG-TGCTACATTAT-AATTGAAGGCTA S_araneus301065 TGTGAGCAGTGTTA--TTTCTTGTG-TGCTACATAAA-AGTTGAAGACTA S_tridecemlineatus300270 TGTGAGCAGTGTTA--TTTCTTATG-TGCTACACAAATAGTTGAAGGTTA T_nigroviridis300089 -G-GGGCTGCGATA--TTTCTGATG-TGCTAGA--ACGAGCTGGAGGTTA T_belangeri300343 TGTAAGCAGTGTTA--TTTCTTATG-TGCTATACAGATTGTTGAAGGTTA X_tropicalis300129 -ATGAGCCGTGTTA--TTTCTAATG-TGCTAAA---TCAATAGGAGGCTA C_familiaris300070 -------ATTAG-CAGTATAACTA--A--ACAATCA------T-CTGCCA C_familiaris300338 -------ATTAG-CAGTATAA---CGAA-ATAGTAA------TACTGCCA C_familiaris300354 -------ATTAG-CAGTATAACTA--A--ATGGTAA------TGCTGCCA C_porcellus300965 -------ATTAG-CAGTATAA---CGAA-ATAGTAA------TACTGCCA C_porcellus301039 -------ATTAG-CAGAATAACTATAA--ATAGTAA------TGCTGCCA D_rerio300227 -------ATTAG-CAGTTTGGCTTCAT--TGTGCCTC-----A-CTGCCA D_novemcinctus300068 -------ATTAG-CAGTATCA---CTAA-ATAGTAA------TGCTGCCA D_novemcinctus300562 -------ATTAG-CAGTATTATAACTAA-ATAATAA------TGCTGCCA D_melanogaster300174 G------CTTAGTTGGACTTGCTACATTCCATGCGTG------GCCACAC E_telfairi300470 -------ATTAG-CAGTTTAACTAAAT--GTAGTAA------TGCTGTCG E_telfairi300812 -------ATTAG-CAGTTTAACTGAAC--GTAGTAA------TGCTGCCA E_telfairi300868 -------ATTAG-CAGTTTAACTAAACATGTAGTAA------TGCTGCCA E_caballus300355 -------ATTAG-CAGTATAACTAAAT--AGTC--------ATGCTGCCA E_europaeus300141 -------ATTAA-CAGTATAGCCAAGT--AGT--------TATGTTACCA E_europaeus300161 -------ATTAA-CAGTGTAACT--AA--ATAGTCA------TGCTGCCA E_europaeus300263 A------ATTAG-CAGTGTAACTAAAT--AAT--------CATGCTGCTA E_europaeus300498 -------ATTAG-CAGTATAACT--AA--ACAGTCA------TGCTGCCA E_europaeus300516 GAAC---ATTAG-CAGTATATCTAAAT--AGTTGTGCTTCCATGCTGCCA E_europaeus300607 -------ATTAG-CAGTGTAACTAAAT--AGT--------CGCGCTGCCA E_europaeus300670 -------ATTAA-GAGTCTAACTAAAT--AGT--------CATGCTGCTA E_europaeus300713 -------ATTAG-CAGTATAACTAGAT--AGA--------CATGCTGCCA F_catus300044 -------ATTAG-CAGTATAACTA--A--ATAGTAA------TGCTGGCA F_catus300320 -------ATTAG-CAGTATAACTA--A--ATAGTAA------TGCTGCCA G_gallus300094 -------ATTAG-CAGCTTAGCTGTAC--GTAGTTAC-----TGCTGCCA H_sapiens300474 -------ATTAG-CAGTATAACTATAA--ATAGTAA------TGCTGCCA L_africana300050 TGCAAATAGTTG-AAGGTTAATTAGCAGTATAAAAAA-------CAAAA- L_africana300062 -------GTTAG-CTGTATAACTA--A--GTAGCAA------TGCTGCCA L_africana300223 -------ATTAG-CAGTGTAACTA-AA--GTAGGAA------TGCTGCCA L_africana300378 -------ATTAG-CAGTATAAATAGTATCCTTCAAA--------CAAAC- L_africana300460 -------ATTAG-CAGTATAACT---A--AGTAGTAA-----TGCTGCCA M_mulatta300137 -------ATTAG-CAGTATAACTATAA--AAAGTAA------TGCTGCCA M_mulatta300138 -------ATTAG-CAGCATGACTA-AT--TTAGTCAT-----TGCTGCCA M_murinus300084 -------GTTAG-CAGTATAGCTATAA--AGAGTAA------TGTTGCCA M_domestica300013 -------ATTAG-CAGCAGAACTTGAT--ATA---AT------GCTGCTA M_domestica300108 -------ATTAG-CAGCATAACTTGGA--ATATTAGTA---CTGCTGCCA M_domestica300109 -------ATTAG-CAGTATAACTTGGT--ATAGTAAT------GCTGCCA M_musculus300364 -------ATTAG-T-GAGTAACTGCCT--ATAGTAA------TTCTGTCA M_musculus300800 -------ATTAG-CAGAGTAACTGAAT--ATAGTAA------TTCTGCCA M_musculus300804 -------ATTAG-CAGAGTAACTGAAT--ATAGTAA------TTCTGCCA O_anatinus304382 -------ATTAG-CAACTTGGCTTGCT--TTCAG-----CTCTGTTGCCA O_anatinus304383 -------ATTAG-CAGCACAACTCTAT--ATAGTAAA-----TGCTGCCA O_anatinus304384 -------ATTAG-CGGCATGTCTA-AT--GTAGCCAT-----TGGCGTCA O_cuniculus300047 -------ATTAG-CCGTGTAACT-TCA--AGTAGTAA-----TGCTGCCA O_cuniculus300335 -------ATTAG-CAGAATA---------GGTAGTAA-----TGCTGCCA O_cuniculus300448 -------ATTAG-CAGTATAACTATCA--AGTAGTAA-----TGCTGCCA O_garnettii300007 -------ATTAA-CAGTGTAACTATAA--ATAGTAA------TGCCGCCA O_garnettii300014 -------ATTAG-CAGTATAACTATCA--ACAGTAA------TGCTGCCC O_garnettii300049 -------ATTAG-CAGTATAACTATAA--ATAGTAA------TGCTGCCA O_garnettii300053 -------ATTAG-CAGTATAATTA--------GTAA------TGCTGCCA O_garnettii300073 -------ATTAG-CAGTATAACTATAA--ATAGTAA------TGCTGCCA O_garnettii300105 -------ATTAG-CAGTATAACTATAA--ATAGTAA------TGCTGCCA O_garnettii300127 -------ATTAT-CAGTGTAACTATAA--ATAGTAA------TGCGACCA O_garnettii300142 -------ATTCA-CAGTATAACTATAA--ATAGTAA------TGCTGCCA O_garnettii300148 -------ATTAG-TGGTATAATTATA------GTAA------TGCTGACA O_garnettii300163 -------ATTAG-CAGTATCACTATAA--ATAGTAA------TGCTGCCA O_garnettii300165 -------ATTAG-CAGTATAACTATAA--ATAGTAA------TGCTGCCA O_garnettii300202 -------ATTAG-CAGTATAACTATAA--GTAATAA------TGCTACTA O_garnettii300213 -------ATTAG-CAGTATAACTATAA--ATAGTAA------TGCTGCCA O_garnettii300252 -------ATTGG-CAATGTAACTATAA--ATAGTAA------TGCTGCCA O_garnettii300264 -------ATTAGGCAGTATAACTATAA--ATAGTAA------TGCTGCCA O_garnettii300321 -------ATTAG-CAGTATCACTATAA--ATAGTAA------TGCTGCCA O_garnettii300351 -------ATTAG-CAGTATAACTATAA--ATAGTAA------TGCTGCCA O_garnettii300365 -------ATTAG-CAGTATGACTATAA--ATAATAA------TGTTGCCA O_garnettii300373 -------ATTAG-CAGTATCACTATAA--ATAGTAA------TGCTGCCA O_garnettii300376 -------ATTAG-CAGTATAACTATAA--ATAATAA------TGCTGCCA O_garnettii300382 -------ATTGG-CAATGTAACTATAA--ATAGTAA------TGCTGCCA O_garnettii300408 -------ATTAC-CAGTATAACTATAA--ATAGTAA------TGTTGCCA O_garnettii300414 -------ATTAG-CAGTATAACTATAA--ATAGTAA------TGCTGCCA O_garnettii300434 -------ATTAG-CAGTATAACTATAA--ATAGTAA------TGCCGCCA O_garnettii300452 -------ATTAG-CAGTCTAACCATAA--ATAGTCA------TGCTGACA O_garnettii300461 -------ATTAG-CAGTATAACTATAA--ATAGTAA------TGCTGCCA O_garnettii300472 -------CTTAG-CAGTATAACCATAA--ATAATAA------TGCTGCCA O_garnettii300507 -------ATTAG-CAGTATCACTATAA--ATAGTAA------TGCTGCCA O_garnettii300565 -------ATTAG-CAATATAACTACAA--ATAGTAA------TGCTGCCA O_garnettii300590 -------ATTCA-CAGTATAACTATAA--ATAGTAA------TGCTGCCA O_garnettii300674 -------ATTAG-CAGTATAACTATAA--ATAGTAA------TGCTGCCA O_garnettii300684 -------ATTAG-CAGTATAAGTATAC--ATAGTAA------GGCTGCCA O_garnettii300718 -------ATTAG-CAGTATAACTATAAG-ATAGTAA------TGCTGCCA O_garnettii300732 -------ATTAG-CAGTATAACTATAA--ATAGTAA------TGCTGCCA P_troglodytes300719 -------ATTAG-CAGTATAACTATAA--ATAGTAA------TGCTGCCA P_pygmaeus300669 -------ATTAG-CAGTATAACTATAA--ATAGTAA------TGCTGCCA R_norvegicus300029 -------ATTAG-CAAAGTAACTACAT--ATAGTAA------TTCTGCCA R_norvegicus300048 -------ATTAG-CAGAGTAACTGCAT--ATAGTAA------TTCTGCCA R_norvegicus300097 -------ATTAG-CAGAGTAACTTCAT--ATAGTAA------TTCTGCCA R_norvegicus300120 -------ATTAG-CAGAGTAACTGCAT--ATAGTAA------TTCTGCCA R_norvegicus300193 -------ATTAG-CAAAGTAACTTCAT--ATAGTAA------TTCTGCCA R_norvegicus300255 -------ATTAG-CAGAGTAACTGCAT--ATAGTAA------TTCTGCCA R_norvegicus300345 -------ATTAG-CAGAGTAACTGCAT--ATAGCAA------TTCTGCCA R_norvegicus300425 -------ATTAG-CAGAGTAACTGCAT--ATAGTAA------TTCTGCCA R_norvegicus300848 -------ATTAG-CAGAGTAACTGCAT--ATAGTAA------TTCTGCCA R_norvegicus300903 -------ATTAG-CAGAGTAACTGCAT--ATAGTAA------TTCTGCCA R_norvegicus300980 -------ATTAG-CAGAGTAACTGCAT--ACAGTAA------TTCTGCCA R_norvegicus301105 -------ATTAG-CAGAGTAACTGCAT--ATAGTAA------TTCTGCCA S_araneus300616 -------ATTAG-CAGTATGATTAAAT--AGTA--------ATACTGCCA S_araneus300997 -------ATTAG-CAGTATGACTAAAT--AGTA--------ATACTGCCA S_araneus301065 -------ATTAG-CAGTATAACTAA-T--AGTA--------ATGCCGCCA S_tridecemlineatus300270 -------ATTAG-CAGAATAACTATAA--ATAGTAA------TGCTGCCA T_nigroviridis300089 -------ATTAG-CAGAGCGGCTGCTG--GGTGCCTC-----GTCTGCCA T_belangeri300343 -------ATTAG-CAGTATAACTATAA--ATAGTAA------TGCTGCCA X_tropicalis300129 -------ATTAG-CAGTGTAACGGAAT--TGTTACCA-------CTGCCA * C_familiaris300070 GTCTCCTT-CAGACAAAC- C_familiaris300338 GCCCCCTT-CAAACAGAA- C_familiaris300354 GTCTCCTT-CAGACACAT- C_porcellus300965 GCCCCCTT-CAAACAGAA- C_porcellus301039 GTCTCCTT-CAGACAGAA- D_rerio300227 GTCCCCTT-CATACAATA- D_novemcinctus300068 GTCGTCTT-CAAACAAAA- D_novemcinctus300562 GTCTTCTT-CAAACAAAA- D_melanogaster300174 GGTACAATTTCGACAGCG- E_telfairi300470 GTCTCATT-CATACAAAA- E_telfairi300812 GTCTCCTT-CACACAAAA- E_telfairi300868 GTCTCCTT-CATACAAAA- E_caballus300355 GTCTCCTT-CAGACAGTT- E_europaeus300141 GTCTCTTT-CAGACAGTT- E_europaeus300161 GTCTCCTT-TGAACAGTT- E_europaeus300263 GTGTCCTT-CAGACAGTT- E_europaeus300498 GTCTCCTT-CACACAGTT- E_europaeus300516 GTCTCCTT-CAGATAGTT- E_europaeus300607 GTCTCCTT-CAGACAGTT- E_europaeus300670 GTCT-----CAGATAGTT- E_europaeus300713 GTCTCCTT-CACACGGGT- F_catus300044 GTCTCCTT-CAGACAAAT- F_catus300320 GTCTCCTT-CAGACAAAT- G_gallus300094 GTCTCCTT-CATACAAAG- H_sapiens300474 GTCTCCTT-CAGACAAAA- L_africana300050 ------------------- L_africana300062 GTCTCCTT-CAAAGAAAA- L_africana300223 GTCTCCTT-TAAAAAAAA- L_africana300378 ------------------- L_africana300460 GTCTCCTT-CAGACAAAC- M_mulatta300137 GTCTCCTT-CAGACAAAA- M_mulatta300138 GTCACCTT-CAAACAAGT- M_murinus300084 GTCTCCTT-CGTATAAAA- M_domestica300013 GT-TCTTT-CAAACAAAC- M_domestica300108 GTCCCCTT-CAAACAAAT- M_domestica300109 GTCTCCTT-CAAACACAC- M_musculus300364 GTGTCCTT-CAGACACAC- M_musculus300800 GTCTCCTT-CAGACAAAA- M_musculus300804 GTCTCCTT-CAGACAAAA- O_anatinus304382 GTCTCCTT-CAGACATTA- O_anatinus304383 GTCCCCTT-CAGACAGAT- O_anatinus304384 GTCCCCTT-CATACAATT- O_cuniculus300047 GTCTCCTT-CACACACAC- O_cuniculus300335 GTCTCTTT-AAGACAGAC- O_cuniculus300448 GTCTCCTT-CAGACACAA- O_garnettii300007 GTCTCCTT-CAGACAAAA- O_garnettii300014 GTCTCCTT-CAGACCAGT- O_garnettii300049 GTCTCCTT-CAGACAAGA- O_garnettii300053 GTCTCCTT-CAGACAAGA- O_garnettii300073 GTCTCCTT-CAGACAAGA- O_garnettii300105 GTCTCCTT-CAGACAAGA- O_garnettii300127 GTCTCCTT-CAGATAAGA- O_garnettii300142 GTCTCCTT-CAGACAAGG- O_garnettii300148 GTCTCCTT-T-GACAAGAA O_garnettii300163 GTCTCCTT-CAGACAAGA- O_garnettii300165 GTCTCCTT-CAGACAAGA- O_garnettii300202 GTCTCCTT-CAGACAAGA- O_garnettii300213 GTCTCCTT-CAGACAAGA- O_garnettii300252 GTCTCCTT-CAGACAAGA- O_garnettii300264 GTCTCCTT-CAGACAAGA- O_garnettii300321 GTCTCCTT-CAGATAAGA- O_garnettii300351 GTCTTTTT-CAGACAAGA- O_garnettii300365 GTCTCTTT-TAGACAAGA- O_garnettii300373 GTCTCCTT-CAGACAAGA- O_garnettii300376 GTCTCCTT-CAGACAAGA- O_garnettii300382 GTCTCCTT-CAGACAAAA- O_garnettii300408 GTCTCCTT-CAGACAAAA- O_garnettii300414 GTCTCCTT-CAGACAAGA- O_garnettii300434 GTCTCCTT-CAGACAAGA- O_garnettii300452 GTCTCCTT-CAGACAAAA- O_garnettii300461 GTCTCCTT-CAGACAAAA- O_garnettii300472 GTCTCCTT-CAGACAAAA- O_garnettii300507 GTCTCCTT-CAGACAAGA- O_garnettii300565 GCCTCCTT-CAGGAAAAA- O_garnettii300590 TTTTCTCT-CAGACAAAA- O_garnettii300674 GTCTCCTT-CAGACAAGA- O_garnettii300684 GTTTCCTT-CAGACAAAG- O_garnettii300718 GTCTCCTT-CAGACAAGA- O_garnettii300732 GTCTCCTT-CAGACAAGA- P_troglodytes300719 GTCTCCTT-CAGACAAAA- P_pygmaeus300669 GTCTCCTT-CAGACAAAA- R_norvegicus300029 GTCCCCTT-CAGACAAAA- R_norvegicus300048 GTCCCCTT-CAGACAAAA- R_norvegicus300097 GTCTCCTT-CAGACAATA- R_norvegicus300120 GTTCCCTT-CAGACAAAA- R_norvegicus300193 GTCTCCTT-CAGACAAAA- R_norvegicus300255 GTCCCCTT-CAGACAAAA- R_norvegicus300345 GTACCCTT-CAGACAAAA- R_norvegicus300425 GTCCCCTT-CAGACAAAA- R_norvegicus300848 GTCCCCTT-CAGACAAAA- R_norvegicus300903 GTCCCCTT-CAGACAAAA- R_norvegicus300980 GTCCCCTT-CAGACAAAA- R_norvegicus301105 GTCCCCTT-CAGACAAAA- S_araneus300616 GTCTCCTT-CAGACAGCT- S_araneus300997 GTCTCCTT-CAGACAGTT- S_araneus301065 GTCTCCTT-CAGACAGCT- S_tridecemlineatus300270 GTCTCCTTTCAGACAAAA- T_nigroviridis300089 GTCCCCTT-CACACACTG- T_belangeri300343 GTCTCCTT-CAGACATAA- X_tropicalis300129 GTCCCCTT-CTCACAGCC-

Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved