snOPY snoRNA Orthological Gene Database
Sorex_araneus SNORA55
sequence
GCACCTGAATCTTTCCCATTCCTGCTGCTTCATGCTGGCGTGGGGACAGATGGTGCAAC
AGTACAAGCAGAGTAAATCCAGACGGGTCGTTTCCATTTTTCTTGGGGCTTGTCTCTACA
GCTCTGCCATACTT
  Box motif
  Complementary to target RNA
length 133
organism Sorex_araneus
snoRNA name SNORA55
alias
chromosome ⁄ contig GeneScaffold_919
locus ⁄ host gene PABPC4
organization Intronic
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved