snOPY snoRNA Orthological Gene Database
Saccharomyces_cerevisiae snR46
sequence
ATGGCCTCTTCGAAGATCCGTAGATTTTGCATTTTTGCGGTGGTTTATGGATTCAAAGC
GAGGCCTAAATTAACGATCATGTCTTTGCTATTATATCAGAGGGCATATCATTGAATTTC
CGATTTCCAAAGGGAAGAAAATAAATAAAGTTGTGCTATTTCCATGCATCCTTTTTTCTT
TCATTCAATGACACATAC
  Box motif
  Complementary to target RNA
length 197
organism Saccharomyces_cerevisiae
snoRNA name snR46
alias
chromosome ⁄ contig VII
locus ⁄ host gene Mono:17:snR46
organization Mono
target RNA 25S rRNA
modification type H/ACA
modification site 25S:U2865
accession no U56647,BK006941
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved