snOPY snoRNA Orthological Gene Database
Saccharomyces_cerevisiae U14
sequence
TCACGGTGATGAAAGACTGGTTCCTTAACATTCGCAGTTTCCACGGTAGGAGTACGCTT
ACGAACCCATCGTTAGTACTCTCGGTGACCGCTCTTCTTTAGAGACCTTCCTAGGATGTC
TGAGTGA
  Box motif
  Complementary to target RNA
length 126
organism Saccharomyces_cerevisiae
snoRNA name U14
alias snR128
chromosome ⁄ contig X
locus ⁄ host gene Poly:1:snR128
organization Poly
target RNA 18S rRNA
modification type C/D
modification site 18S:C414
accession no BK006943,X96815
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved