snOPY snoRNA Orthological Gene Database
Rattus_norvegicus SNORA55
sequence
GCACTCAAATCTTTCCCAGGCCTGCTTGCTTGGTGCTGGTCTGGGGACAGGCAGTGCTA
TAGTAGAGCAGAGGAAATCCAGACGGGTCGTTTCCATCTGTCCTGGGGCCTGTCCCTACA
ACTCTGCCACACTT
  Box motif
  Complementary to target RNA
length 133
organism Rattus_norvegicus
snoRNA name SNORA55
alias
chromosome ⁄ contig 5
locus ⁄ host gene
organization Intronic
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved