snOPY snoRNA Orthological Gene Database
Rattus_norvegicus SNORA16
sequence
GGCAGCCCTTATTAAAGCTGTAGCTGCTTCCACATAGCTGGTGTGGTCAAACACAAGTC
CCAAGTAACAGTTTTCCTTAACTGTCATGGTTCCATTTGCAGTAACACATCTGTAAGATT
TTGAGAAAAGACAGTT
  Box motif
  Complementary to target RNA
length 135
organism Rattus_norvegicus
snoRNA name SNORA16
alias
chromosome ⁄ contig X
locus ⁄ host gene Mono:22:SNORA16
organization Mono
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved