snOPY snoRNA Orthological Gene Database
Pongo_pygmaeus SNORD14
sequence
GAGTGCTTATTAGTGTGACTTTCTTAGTCACAATTCATACACAGTGACCATGGGAGAGT
GATTTTCATGCTTCTTTAAAGCAATGGTTGTTCTTGCTTGGATGTCTGAGCTT
  Box motif
  Complementary to target RNA
length 112
organism Pongo_pygmaeus
snoRNA name SNORD14
alias
chromosome ⁄ contig 8
locus ⁄ host gene Mono:218:SNORD14
organization Mono
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved