snOPY snoRNA Orthological Gene Database
Otolemur_garnettii SNORA16
sequence
GGCTGGTTTATGGAAAGCATAAGAGTGCACGGCTGCTGTGGTCACAAGGCAGCCCATCG
AGGTGACAGTTTCCCTTGATGGCTGCCGTTCTGTTTGTGGCTACTGATCTGCAACATTTT
GGGGAAAATACAGT
  Box motif
  Complementary to target RNA
length 133
organism Otolemur_garnettii
snoRNA name SNORA16
alias
chromosome ⁄ contig scaffold_86258
locus ⁄ host gene Mono:3:SNORA16
organization Mono
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved