snOPY snoRNA Orthological Gene Database
Otolemur_garnettii SNORA19
sequence
TGGCATGAATGGACAAGAATGGAGAAAGGTGTTATTTCTTATGTGCTATACGAATAGTT
GAAGATTAATTAGCAGTATAACTATAAATAGTAATGCTGCCAGTCTCCTTCAGACAAGA
  Box motif
  Complementary to target RNA
length 118
organism Otolemur_garnettii
snoRNA name SNORA19
alias
chromosome ⁄ contig scaffold_88562
locus ⁄ host gene Mono:12:SNORA19
organization Mono
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved