snOPY snoRNA Orthological Gene Database
Oryzias_latipes SNORD14
sequence
TCGCAATGATGATGTCATTTCCTGCCATTCGTAGTTTCCACCAGAGGTCTAACGGCCAA
AGATGGTCCAAACCTTCCTTGGATGTCTGAGCGA
  Box motif
  Complementary to target RNA
length 93
organism Oryzias_latipes
snoRNA name SNORD14
alias
chromosome ⁄ contig 18
locus ⁄ host gene Poly:5:SNORD14
organization Poly
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved