snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus SNORD66
sequence
TTCCGTTGATGACTTTCTGATAGTGCCACGTGTCTGGGCCACTGAGTCCTCATGATGGA
ACTGAGGATCTGAGGAA
  Box motif
  Complementary to target RNA
length 76
organism Oryctolagus_cuniculus
snoRNA name SNORD66
alias
chromosome ⁄ contig GeneScaffold_1879
locus ⁄ host gene Q6EVH7_RABIT
organization Intronic
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved