snOPY snoRNA Orthological Gene Database

Family: SNORD66

CLUSTAL 2.0.10 multiple sequence alignment C_elegans300083 -----CGATG-ATGATGAAG-AATTTTTGATATGGTGTCAGGACCTCTGAGAG-TTCCGT C_familiaris300422 --TTCCACTG-ATGACTTCT-TGTTAGTGCCA-CGTGTCTGGGCCACTGAGA--CCACAT C_porcellus300868 --TTCCGATG-ATGACTTCT-TGTTAGTGCCA-CGTGTCTGGGCCACTGAGA--CCCCAT D_rerio300097 --CTCCACTG-ATGACC-TT-CATTAAGAGCCACGTGTCTGGGCCACTGATC--TACACT D_rerio300188 --CTTCATTG-ATGA---CC-TGTTT-------------TGTGCCACTGATG--TATTGT E_telfairi300375 --TTCCTGTG-ATGACTTCA-TGTTC---AAG-TATAAAGAGGAAACCGAGTT-CTCAAT E_telfairi300635 ----TCATCATATTAACCTT-TTTTGGTGGGG-GGGGCGGGGGGGAGGGAGT--GTTACA E_caballus300346 --TTCCGCTG-ATGACTTCT-TGTTAGTGCCA-CGTGTCTGGGCCACTGAGA--CCCCAT E_europaeus300229 --TTCCACTG-ATGATGCTT-TGTTAGTGCCA-CATGTCTGGGCCACTGAGA--TCCCAT E_europaeus300406 --TTCCACTG-ATGACACTT-T--TAGTGCCA-CGTGTTTGGGCCACTGAGA--CCCCAT E_europaeus300678 --TTCCACTG-ATGACGCTT-TGTTAGTGCCA-CGTGTCTGGGCCACTGAGA--CCCCAT F_catus300299 --TTCCGTTG-ATGACTTCT-TGTTAGTGCCA-CGTGTCTGGGCCACTGAGA--CCGTGT G_gallus300109 --TTCTTGTG-ATGAATTCT-ACTTTGTGCCATCGTGTCTGGGCCACTGATA--CTTCAT G_gallus300110 CTTCTCTGTG-ATGATCAAG-CCTTTGAGCCACTGTGTCTGGGCCACTGATG--T-CAGT H_sapiens300614 --TTCCTCTG-ATGACTTCC-TGTTAGTGCCA-CGTGTCTGGGCCACTGAGA--CACCAT M_mulatta300202 AGTTCCTGCATCCTGCACTG-TGGCCTGAAAA-CTCTCTCAAGAAAGTAAGTTGCTCTAT M_mulatta300520 --GTCCTCTG-ATAACTTCG-TGTTAGTGCCA-CCTGTCTGGGCCACTGAGT--ACCCAT M_mulatta300606 --TTCCTCTG-ATGACTTCC-TGTTAGTGCCA-CGTGTCTGGGCCACTGAGA--CCCCAT M_murinus300503 --TTCCTCTG-ATGACTTCA-TGTTAGTGCCA-CGTGTCTGGGCCACTGAGA--CCCCAT M_domestica300103 --CTTCACTG-ATGAGATCC-TGTTTGTGCCGTCGTGTCTGGGCCACTGAAG--CCTTGT M_domestica300104 --CTCCACTG-ATGACCACC-TATTTGGGCCGTTGTGTCTGGGCCACTGAGT--TTTGTT M_domestica300105 --CTCCAGTG-ATGA---CC-TTTTGAGTACCATGTGTCTGGGCCACTGAGA--TACTGT M_musculus300873 --TTCCGCTG-ATGACTTCT--GTCAGTGCCA-CGTGTCTGGGCCACTGAGA--CCACAT O_anatinus303005 --CTTCGCTG-ATGACTCCC-TGTTCGTGCCGTCGTGTCTGGGCCACTGAGA--CCTGGT O_anatinus303544 --CTCCGCTG-ACGAATGCT-TGTTTGAGCCATCGTGTCTGGGCCACTGACA--CCCCGT O_cuniculus300456 --TTCCGTTG-ATGACTTTC-TGATAGTGCCA-CGTGTCTGGGCCACTGAGT--CCTCAT O_latipes300087 --CTCTGATG-ATGACTCCT-GTTTTGTGCCA-CGTGTCTGGGCCACTGAAT--GCTCAT O_garnettii300639 --TTCCTCTG-ATGACTTCA-TGTTAGTGCCA-CGTGTCTGGGCCACTGAGA--CCCCAT P_troglodytes300322 AGTTCCTGCATACTGCACTG-TGGCCTGAAAA-CTCTCTCAAGAAAGTGAGTTGCTCCAT P_troglodytes300324 --GTCCTCTG-ATGACTTCA-TGTTAGTGCCA-CCTGTCTGGGCCACTGAGA--ACCCAC P_troglodytes300631 --TTCCTCTG-ATGACTTCC-TGTTAGTGCCA-CGTGTCTGGGCCACTGAGA--CACCAT P_pygmaeus300212 --GTCCTCTA-ATGACTTCA-TGTTAGTGCCA-CCTGTCTGGGCCACTGAGA--ACCCAT P_pygmaeus300514 --TTCCTCTG-ATGACTTCC-TGTTAGTGCCA-CGTGTCTGGGCCACTGAGA--CCCCAT P_pygmaeus300673 AGTTCCTGCATACTACACTG-TGGCCTGAAAA-CTCTCTCAAGAAAGTAAATTGCTCCAT R_norvegicus301036 --TTCCGCTG-ATGACGTCT--GTTAGTGCCA-CGTGTCTGGGCCACTGAGA--GCACAT S_araneus301059 --TTCCACTG-ATGACTTCTGTGTTAGTGCCA-CGTGTCTGGGCCACTGAGA--CCTCCT T_nigroviridis300168 --CTCCAATA-CTGACTGGTGTG-TGGTGCCA-CGCCTCTAGGCCTCAGAAT--TACCCT T_belangeri300365 --TTCCACTG-ATGACTTCC-TGTTAGTGCCA-CGTGTCTGGGCCACTGAGA--CCCCAT * C_elegans300083 GATGATGTTTAGAGTTCCTGAATCTT C_familiaris300422 GATGGAACTGAGGATCTGAGGAA--- C_porcellus300868 GATGGAACTGAGGACCTGAGGAA--- D_rerio300097 GATGGGATTGAGGAACTGAGGAG--- D_rerio300188 AATGGTAATGAGGATCTGAAGAG--- E_telfairi300375 GAAGGGGCCGAGGAT----------- E_telfairi300635 CACCCATCTGAGAATCTGAGGAA--- E_caballus300346 GATGGAACTGAGGATCTGAGGAA--- E_europaeus300229 GATGGAACTGAGCATGTATGAGG--- E_europaeus300406 GATGGAACTGAGGAGCTGAGGAA--- E_europaeus300678 GATGGAACTGAGGAGCTGAGGAA--- F_catus300299 GATGGAACTGAGGATCTGAGGAA--- G_gallus300109 GATGGTAAAGAGGATCTGAGGGG--- G_gallus300110 GATGGAACTGAGGATCTGAGCAG--- H_sapiens300614 GATGGAACTGAGGATCTGAGGAA--- M_mulatta300202 GATGGAACTGAGGATCTGAGGAA--- M_mulatta300520 GATGGAACCGAGGATCTGAGGAA--- M_mulatta300606 GATGGAACTGAGGATCTGAGGAA--- M_murinus300503 GATGGAACTGAGGATCTGAGGAA--- M_domestica300103 GATGGAGTTGAGGATCTGAGGAG--- M_domestica300104 GATGGAACTGAGGTTCTGAGGAG--- M_domestica300105 GATGGAGCTGAGGTTCTGAGGAG--- M_musculus300873 GATGGGATTGAGGACCTGAGGAA--- O_anatinus303005 GATGGAGATGAGGATCTGAGGAAG-- O_anatinus303544 GATGGAACTGAGGATCTGAGGAG--- O_cuniculus300456 GATGGAACTGAGGATCTGAGGAA--- O_latipes300087 GATGGCAATGAGGATCTGAAGAA--- O_garnettii300639 GATGGAACTGAGGATCTGAGGAA--- P_troglodytes300322 GATGGAACTGAGGATCTGAGGAA--- P_troglodytes300324 GATGGAACTGAGAATCTGAGGAA--- P_troglodytes300631 GATGGAACTGAGGATCTGAGGAA--- P_pygmaeus300212 GATGGAACTGAGAATCTGAGGAA--- P_pygmaeus300514 GATGGAACTGAGGATCTGAGGAA--- P_pygmaeus300673 GATGGAACTCAGGATCTGAGGAA--- R_norvegicus301036 GATGGGATTGAGGATCTGAGGAA--- S_araneus301059 GATGGAACTGAGGATCTGAGGAA--- T_nigroviridis300168 GATGGTTTTGAGGAACTAATGGCA-- T_belangeri300365 GATGGAACTGAGGATCTGAGGAA--- * **

Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved