snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus SNORD24
sequence
CACAGATGACGTGAAGGAATATTTGCTATCTGAGTGTGGTGACGACATCAACACCACCC
AGATGGCTGATGTG
  Box motif
  Complementary to target RNA
length 73
organism Oryctolagus_cuniculus
snoRNA name SNORD24
alias
chromosome ⁄ contig GeneScaffold_611
locus ⁄ host gene Mono:207:SNORD24
organization Mono
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved