snOPY snoRNA Orthological Gene Database
Ornithorhynchus_anatinus SNORD38
sequence
CTTCACGTGATGATAATATTGTCCAGTTCTGCTACTGAAGGGACAGCGGTGACACCCTT
AGAATCTGAAGAAG
  Box motif
  Complementary to target RNA
length 73
organism Ornithorhynchus_anatinus
snoRNA name SNORD38
alias
chromosome ⁄ contig Ultra56
locus ⁄ host gene ENSOANG00000033332
organization Intronic
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved