snOPY snoRNA Orthological Gene Database
Myotis_lucifugus SNORA25
sequence
AGGTCATTTCAGAGAGAGCTTGTGGAACCAAAACCAGGAGCTCTTAACACTGTGACTAA
GGATTGAAGTTCTCCATATGTAACTGTCACTCAAGAATACTGTGTTTTCCCGAGGAGATA
AAAGA
  Box motif
  Complementary to target RNA
length 124
organism Myotis_lucifugus
snoRNA name SNORA25
alias
chromosome ⁄ contig scaffold_325
locus ⁄ host gene TMEM182
organization Intronic
target RNA 18S rRNA
modification type H/ACA
modification site 18S:U802,18S:U815
accession no AAPE02041354.1
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved