snOPY snoRNA Orthological Gene Database
Myotis_lucifugus SNORA25
sequence
aggtcatttcaaatagggctaatggggctgtgaaatcgggagctcttaattttatgact
aaagattgaggttctccatagagtgtcatagtcacccaatagtactaagtatttttgaga
atatatgatc
  Box motif
  Complementary to target RNA
length 129
organism Myotis_lucifugus
snoRNA name SNORA25
alias
chromosome ⁄ contig scaffold_5
locus ⁄ host gene Mono:419:SNORA25
organization Mono
target RNA
modification type H/ACA
modification site
accession no AAPE02004837.1
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved