snOPY snoRNA Orthological Gene Database
Myotis_lucifugus SNORA25
sequence
GGGTCATTTCAAAGAGAGCTTATGGGACTAAAACCAGGAGCTCTTAACGCTGTGACCGA
AAATTGAAGTTCTCCATAGGATGTAATAAACACTCAATAGTGTCTATTTTGTCCTGAAGA
GATATATGA
  Box motif
  Complementary to target RNA
length 128
organism Myotis_lucifugus
snoRNA name SNORA25
alias
chromosome ⁄ contig scaffold_104
locus ⁄ host gene TAF1D
organization Intronic
target RNA
modification type H/ACA
modification site
accession no AAPE02025112.1?
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved