snOPY snoRNA Orthological Gene Database
Myotis_lucifugus SNORA25
sequence
AGGTCATTTCAAAGAGGGCTTGCAGGACTGTGACACCAGGAGCTCTTAACTCTGTGGCT
GAAGACCAAAGTTCTCCACAGGATGCCATAGTCACTCAATAGCGCTGTGTGTTCCTGAAG
AGACATAGCC
  Box motif
  Complementary to target RNA
length 129
organism Myotis_lucifugus
snoRNA name SNORA25
alias
chromosome ⁄ contig scaffold_23
locus ⁄ host gene Mono:255:SNORA25
organization Mono
target RNA 18S rRNA
modification type H/ACA
modification site 18S:U802
accession no AAPE02011553.1
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved