snOPY snoRNA Orthological Gene Database
Mus_musculus SNORD57
sequence
TGGAAAGGATGAACGAACTTGGCCTGACCTTCAGAAATGGAGGCAATACAACTGATTTA
ATGAGCCTGATCC
  Box motif
  Complementary to target RNA
length 72
organism Mus_musculus
snoRNA name SNORD57
alias
chromosome ⁄ contig 2
locus ⁄ host gene Nol5a
organization Intronic
target RNA 18S rRNA
modification type C/D
modification site 18S:A99
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved