snOPY snoRNA Orthological Gene Database

Family: SNORD57

CLUSTAL 2.0.10 multiple sequence alignment C_familiaris300449 TGGAGGTGATGAACAGGC----TTAGCCTGACTTT-GTAGAGTGGAGG-- C_familiaris300478 TGAAGGTGATGAACTGTT----TTAGCCTGACTTT-GCATCGCAGAGG-- D_rerio300281 TGTGAGTGATGACTCTTT----CC-TCCTGACTCC---TACGTGGAGG-- D_novemcinctus300139 TGGAGGTGAGGAGCTGTC----TTAGCCTGACCTT-G-AAAGTAGGGG-- E_telfairi300046 ----------------------GGGAGTTGACCTT-GTAAAGTGAAGG-- E_caballus300255 TGGAGGTGATGAGCTGTC----TTAGCCTGACCTG-GTAGAGTGGAGG-- E_caballus300312 TGAGAGTGATGAACTGTC----TTACTCTGATCTT-GTAGAATGGAGG-- E_europaeus300207 TGGAGGTGATGAACTATTA---TTAGTCTGACTTT-GTAGACTGGAGG-- E_europaeus300603 TGGAGGTGATGAACTATTA---TTAGCCTGACTTT-GTAGACTGGAGG-- F_catus300084 TGGGGGTGATGAACTGGC----TTAGCCTGACTTT-GTAGAGTAGAGG-- F_catus300313 TGGAGGTGATGAACTGGC----TAAGCCTGACTTT-GTAGAGTGGAGG-- H_sapiens300479 TGGAGGTGATGAACTGTC----TGAGCCTGACCTT-GTAGAATGGAGG-- L_africana300440 TGGAAGTGATGAACTGTC----TTAGCCTGACTTT-GTAAAGTGGAGG-- M_mulatta300530 TGGAGGTGATGAACTGTC----TGAGCCTGACCTC-GTAGAGTGGAGG-- M_murinus300458 TGGAGGTGATGAACTGTC----TCAGCCTGACCTT-GTAGAGTGGAGG-- M_domestica300173 TGGAGGTGATGAGCATCC----TTACCCTGACTCC---AGAGTGGAGG-- M_musculus300983 TGGAAAGGATGAACGA----ACTTGGCCTGACCTT-CAGAAATGGAGGCA O_anatinus302232 TGGAGATGATGAGCCA-----CTTGGTCC--------TGAACCTAGCGTG O_cuniculus300227 TGGAAGTAATGAGCTGCT-----TAGCCTGACCTT-CTAGAGTGGAGG-- O_cuniculus300233 TGGAGGTGATGGGCAGCC----TCGGCCTGACCTT-GTAGAGTGGAGG-- O_latipes300063 TGTAAATGATGAAAGGTC----TTTCCCTGATGTC---ACAGTGAGGG-- O_garnettii300008 ----GGTGATGAACTGTC----TTAGCCTGACCTT-ACAGAATG-AGG-- O_garnettii300658 TGGAGGTGATGAACTGCC----TTAGCCTGACCTTAGTCGAGTGGAGG-- P_troglodytes300724 TGGAGGTGATGAACTGTC----TGAGCCTGACCTT-GTAGAATGGAGG-- P_pygmaeus300623 TGGAGGTGATGAACTGTC----TGAGCCTGACCTT-GTAGAATGGAGG-- R_norvegicus300953 TGGAGATGATGAACTG----ACTCAGCCTGACCTT-CAGAAATGGAGGTG S_araneus301041 TGGAGATGATGAACTCTCT---TGGGCCTGACCTT-GTTGAGTGGAGGGG S_tridecemlineatus300313 TGGAGATGATGAACCATCTTGCTTGGCCTGACCTT-GTGAAGTGGAGGCA T_nigroviridis300075 TGTAAGTGATGACCCCTC----TT-CCCTGATGTC---CC--TGAAGG-- T_belangeri300340 TGGACATGATGAATTGTT----CTAACCTGACCTC-GTAGA-TGGAGG-- X_tropicalis300039 CGGAGATGATGTCAATCTT---TTGCCCTGACCTG--AAGCCATGAGG-- * C_familiaris300449 C-AAAAAA--CTGATTTAATGAGCCTGATCC C_familiaris300478 CAAAAAAA--CTAATATAATAAATATTT--- D_rerio300281 CGAAAA----CTGATTTAATGAGCCTGACAC D_novemcinctus300139 CAA-AAAA--CTGGTTTAATGAGCCTAATCC E_telfairi300046 CAAAAACA--CTGATTTAATTAGCCTGATCC E_caballus300255 CAA-AAAA--CTGATTTAATGAGCCTGATCC E_caballus300312 CAGAAAA---CTGACTTAATATATATTC--- E_europaeus300207 CAAAAAAA--CTGATTTAATGAGCCTGATCC E_europaeus300603 CAAAAAAA--CTGATTTAATGAGCCTGATCC F_catus300084 CGAAAAAA--CTGATTTAATGAGCCTGATCC F_catus300313 CAAAAAAA--CTGATTTAATGAGCCTGATCC H_sapiens300479 CAAAAAAA--CTGATTTAATGAGCCTGATCC L_africana300440 CAAAAAA---CTGATTTAATGAGCCTGATCC M_mulatta300530 CAAAAAAAA-CTGATTTAATGAGCCTGATCC M_murinus300458 CAAAAAAA--CTGATTTAATGAGGCTGATCC M_domestica300173 CAAAAA----CTGATTTAATGAGCCTGATCC M_musculus300983 AT----ACAACTGATTTAATGAGCCTGATCC O_anatinus302232 AGGGCAAAAGCTGATTTAATGAGCCTGATCC O_cuniculus300227 CAAAAAAA--CTGATTTAATGAGCCTGATCC O_cuniculus300233 CGACAAAA--CTGATTTAATGAGCCTGATCC O_latipes300063 TGAAAA----CTGATTTAATGAGCCTGATGC O_garnettii300008 CAAAAAC---CTGATTTAGTGAGCTTGA--- O_garnettii300658 CAAAAAAAA-CTGATTTAATGAGCCTGATCC P_troglodytes300724 CAAAAAAA--CTGATTTAATGAGCCTGATCC P_pygmaeus300623 CAAAAAAA--CTGATTTAATGAGCCTGATCC R_norvegicus300953 AT----AAAACTGATTTAATGAGCCTGATCC S_araneus301041 CAAAAAATAATTGATTTAATGAGCCTGATCC S_tridecemlineatus300313 AAAACAAAAACTGATTTAATGAGCCTGATCC T_nigroviridis300075 TCAAAA----CTGGTTTAATGAGCCTGATGC T_belangeri300340 CAAAAAAA--CTGATTTAATGAGCCTGATCC X_tropicalis300039 CAAAAA----CTGATTTAATGAGCCTGATCC * ** * *

Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved