snOPY snoRNA Orthological Gene Database
Mus_musculus SNORD66
sequence
TTCCGCTGATGACTTCTGTCAGTGCCACGTGTCTGGGCCACTGAGACCACATGATGGGA
TTGAGGACCTGAGGAA
  Box motif
  Complementary to target RNA
length 75
organism Mus_musculus
snoRNA name SNORD66
alias
chromosome ⁄ contig 16
locus ⁄ host gene Eif4g1
organization Intronic
target RNA 18S rRNA
modification type C/D
modification site 18S:C1272
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved