snOPY snoRNA Orthological Gene Database
Mus_musculus SNORA19
sequence
TTGCACATTTCATTGACCTGCTTTCTTTTGAAAATGTGAGCAGTGTTATTTCTTATGTG
CTATACAAATAGTTGAAGGTTAATTAGCAGAGTAACTGAATATAGTAATTCTGCCAGTCT
CCTTCAGACAAAA
  Box motif
  Complementary to target RNA
length 132
organism Mus_musculus
snoRNA name SNORA19
alias ACA19
chromosome ⁄ contig 19
locus ⁄ host gene Cbwd1
organization Intronic
target RNA 28S rRNA
modification type H/ACA
modification site 28S:U3386,28S:U3295,18S:U864
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved