snOPY snoRNA Orthological Gene Database
Mus_musculus SNORD70
sequence
CTCAATGTTGTCAATGATGCATCTTATTGGAACTGAATTTAAGTGATCTAACCCATTCG
TCACTACCACTGAGACAACATTGAG
  Box motif
  Complementary to target RNA
length 84
organism Mus_musculus
snoRNA name SNORD70
alias
chromosome ⁄ contig 1
locus ⁄ host gene Nol5
organization Intronic
target RNA 18S rRNA
modification type C/D
modification site 18S:A513
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved