snOPY snoRNA Orthological Gene Database

Family: SNORD70

CLUSTAL 2.0.10 multiple sequence alignment C_familiaris300379 --TTCATTGTTGTCAATGATGTA--TTCTTGTTGGAAC--TGAATAT-AA C_familiaris300380 --TTCAATGTTGTCAATGATGCA--TTCTT-TTGGAAT--TGAATTT-AA C_porcellus300426 ----ATCATGTGTCA-TGATGTA--TTCCTGTTGGAAC--TGAATCT-CA C_porcellus300427 --TTCAATGTTGTCAATGATGCA--TCCTTAATGCAAC--TGAGTTT-AA D_rerio300220 AAATCTGTGCG-TCTATGATGTTTCTGTTCACCCAATT--CAACCATGAG D_novemcinctus300556 -TTCATTGTGGGTCAATGATGTA--TTCTTGTTGGAAC--TGAATCT-AA D_melanogaster300076 TTCGCAGTGATGTTAAACCTGTTTTGATTTTGTGTATCAACGAAAATATG E_telfairi300703 -TTCATTGTTG-TCAATGATGTA--TTCTTGTTGGAAA--TGAATCT-AA E_telfairi300704 --CTCGATGTTGTCAATGATGCA--TTCTTGTTAGAAC--TGAATTT-AT E_caballus300390 -TTCATTGTTG-TCAATGATGTA--TTCTTGTTGGAAC--TGAATCT-AA E_caballus300391 --TTCAATGTTGTCAATGATGCA--TTCTTTTTGGAAC--TGATTTT-AA E_europaeus300119 --ATCGTTGTTGTCAATGATGTA--GTCATGTTGGAAC--TGAATCTTAA E_europaeus300605 --ATCGTTGTTGTCAATGATGTA--GTCATGTTGGAAC--TGAATCTTAA E_europaeus300606 --ACCAATGTTGTCAATGATGCA--TTCAT-CCGGAAC--TGAATTT-AA F_catus300329 --TTCATTGTTGTCAATGATGTA--TTCTTGTTGGGAC--TGAATAT-AA G_gallus300095 --TAGTCTGTTGTCAATGATGGA--TACCTGTTGGAAC--TGA-ATGTAG G_gallus300096 CCCAGACTGTTGTCAATGATGAA---ACATAGTTAAGC--TGA-AAATAA H_sapiens300504 --TTCGTTGTTGTCAATGATGTA--TTCTTCTTGGAAC--TGAATCT-AA L_africana300519 -TTCATTGTTG-TCAATGATGTA--TTCTTGTCGGAAC--TGAGTCT-AA L_africana300520 --TTCAATGTTGTCAATGATGCA--TTCTTGTTGGAAC--TGAATTT-AA M_mulatta300374 --TTCGTTGTTGTCAATGATGTA--TTCTTGTTGGAAC--TGAATCT-AA M_mulatta300732 --TTCATTGTTGTCAATGATGTA--TTCTTGTTGGAAC--TGAATCT-AA M_mulatta300733 --TTCAATGTTGTCAATGATGCA--TTCTTACTGGAAC--TGAATTT-AA M_murinus300243 --GACATGCCTGTCAATGACGTA--TTCTTTTTGGAAC--TGAATCT-AA M_domestica300181 --CTTATTGTTGTCAGTGATGGA--TTT-TGTTGAA-T--GAA-AAACAA M_domestica300182 ----TTTTGTTGTCAGTGATGTA--CATATGTTGGAAC--TGAATCTTAA M_musculus300677 ---------TTGTCAATGATTCA--TTTCTTTTGGAAC--TGAATCT-AG M_musculus300782 --TTCATTGTTGTCAATGATGTA--TACCTTTTGGAAC--TGAATCT-AA M_musculus300783 --CTCAATGTTGTCAATGATGCA--TC-TTATTGGAAC--TGAATTT-AA O_anatinus302425 --CTCTTTGTTGTCAATGATGCA--TTCATGTTGAAAC--TGA-ATCCAA O_anatinus302426 --TTGTCTGTTGTCAATGATGCA--TTCTTGTTGGAAC--TGAATCA-AA O_cuniculus300166 -TTCATCGTTG-TCAATGATGTA--TTCTTGTTGGAAC--TGAATCC-AA O_cuniculus300508 --CTTGATGTTGTCAATGATGCA--TTCTTAATGGAAC--TGAATTT-AA O_garnettii300288 --TTTCTTTTTCTTAAGAATTAA--ATTCCT--GGAAC--TGAATCT-AA O_garnettii300450 ------GGCATGTCAATGGTATA--TTCTTGTTGGGAC--TGAATCT-AA P_troglodytes300638 --TTCGTTGTTGTCAATGATGTA--TTCTTCTTGGAAC--TGAATCT-AA P_troglodytes300639 --TTCAATGTTGTCAATGATGCA--TTCTTATTGGAAC--TGAATTT-AA P_pygmaeus300692 --TTCGTCGTTGTCAATGATGTA--TTCTTGTTGGAAC--TGAATCT-AA P_pygmaeus300693 --TTCAATGTTGTCAATGATGCA--TTCTTATTGGAAC--TGAATTT-AA R_norvegicus300670 -------GATTGTCAATGAAGTA--TTTCCTTTGGAAC--CGAATCT-AA R_norvegicus300850 --TTCATTGTTGTCAATGATGTA--TACCTTTTGGAAC--TGAATTT-AA R_norvegicus300851 --CTCAATGTTGTCAATGATGCA--TC-TTACTGGAAC--TGAGTTT-CA S_araneus300900 --TCCATTGTTGTCAATGATGTA--TT---GTTGGAAC--TGAAT-TAAA S_araneus300901 --CTCAATGTTGTCAATGATGTA--TTCTTTTTGGAAC--TGAATTT-AA S_tridecemlineatus300248 --TTCAATGTTGTCAATGATGCA--TTCTTAATGGAAC--TGAATTT-AA T_nigroviridis300023 ----------TGCCAATGATTA---CACTTGCTGCCCG--AAACATTTGT T_nigroviridis300024 --TTCTGTGTGGTCGATGATGCAGTTATGTGTCTGATT--AAAACATGAG T_belangeri300374 --TTCATTGTTGTCAATGATGTA--TTCTTGTTGGAAC--TGAATCT-AA T_belangeri300375 --TTCAATGTTGTCAATGATGCA--TTCTTGTTGAAAC--TGAATT--AC X_tropicalis300116 --TTCCATATTGCCAATGATGGAT-CCTTTGTTGAACT--GATTACTTGT C_familiaris300379 ATGATCTAACTCAAATA-TTCGTCACTACCACTGAGACAACAATGAG- C_familiaris300380 GTGATCTAACTCAAA---TTCGTCGCTACCACTGAGACAACATTGAG- C_porcellus300426 GTGATCTAACTCAAATA-TTCGTCACTACCACTGAGGCAACAATGAA- C_porcellus300427 GTGATCTAACTCAAA---TTCGTCACTACCACTGAGACAACGTTGAG- D_rerio300220 GTCACCAAAC---AGTTATTCGTCACTACCACTGAGACCACAATTAT- D_novemcinctus300556 GTGATCTAACTTAAAGA-TTCGTCACTATCACTGAGACAACGATGAA- D_melanogaster300076 AAATTATAATTTTCTTA-TTCGTCACTACCTCTGAGTAA--------- E_telfairi300703 GTGATCTAAC--AAATA-TTCGTCACTACCACTGAGATGACAATGAA- E_telfairi300704 GTGATCTAACTCAGA---TTCGTCACTACCACTGAGACAACATTGAG- E_caballus300390 GTGATCTAACTCAAATA-TTCGTCACTACCACTGAGACAACGATGAA- E_caballus300391 GTGATCTAAGTCA-----TTCGTCACTACCACTGAGACAACATTGAG- E_europaeus300119 GTGATCTGACAT-ATA--TTCGTCACTACCACTGAGACAGCAATGTA- E_europaeus300605 GTGATCTGACAT-ATA--TTCGTCACTACCACTGAGACAGCAATGTA- E_europaeus300606 GTGATCTAACTCAAA---TTCGTCACTACCACTGAGACAACATTGAG- F_catus300329 ATGATCTAACTCAAATA-TTCGTCACTACCACTGAGACAACAATGAA- G_gallus300095 CTGATTTGAGTCAACAT-TTCGTCCCTACCACTGAGACAACAAACAG- G_gallus300096 -TGATATAATTCAGTTCCTTCGTCACTACCACTGAGACAACAGATGGG H_sapiens300504 GTGATCTGACTC-AATA-TTCGTCACTACCACTGAGACAACGATGAA- L_africana300519 ATGATCTAACTTAAATA-TTCGTCACTACCACTGAGATGACAATGAA- L_africana300520 GTGATCTAACTCAAA---TTCGTCACTACCACTGAGACAACATTGAG- M_mulatta300374 GTGATCTGACTC-AATA-TTCGTCACTACCACTGAGACAACAATGAA- M_mulatta300732 GTGATCTGACTC-AATA-TTCGTCACTACCACTGAGACAACAATGAA- M_mulatta300733 GTGATCTGACTCA-----TTCGTCACTACCACTGAGACAACATTGAG- M_murinus300243 GTGATCCAACTCAAATA-TTCATTACCAACACTGAGAGAGCAATGAA- M_domestica300181 GTGATTTGAC------A-TTCGTCACTACCACTGAGACAACAGGGAA- M_domestica300182 GTGATATCATTTACCAA-TTCGTCACTACCACTGAGACAACACTGAA- M_musculus300677 TGAATTTAGC---AATT-TTC--CACTATCACTGAGGCAGAGAGAGA- M_musculus300782 GTGATTTAAC--AAAAA-TTCGTCACTACCACTGAGACAACAATGAA- M_musculus300783 GTGATCTAACCCA-----TTCGTCACTACCACTGAGACAACATTGAG- O_anatinus302425 GTGATTTAACTGAACAA-TTCGTCACTACCACTGAGACAACACAAAA- O_anatinus302426 ATGATTTAATTCAACAA-TTCGTCACTACCACTGAGACAACACTGAA- O_cuniculus300166 ATGATCTAACTCAGATA-TTCGTCACTACCACTGAGACAGCGATGAA- O_cuniculus300508 GTGATCTGACTCAAA---TTCGTCACTACCACTGAGACAACATTGAG- O_garnettii300288 GTGATATAACTCAAATG-TTCATCACTACCACTGAGAGGGCAATGAC- O_garnettii300450 GTGGTCTAACACCAGCA-TTTGTTACTAACACTGAGACAACAATGCC- P_troglodytes300638 GTGATCTGACTC-AATA-TTCGTCACTACCACTGAGACAACGATGAA- P_troglodytes300639 GTGATCTGACTCA-----TTCGTCACTACCACTGAGACAACATTGAG- P_pygmaeus300692 GTGATCTGACTC-AATA-TTCGTCACTACCACTGAGACAACGATTAA- P_pygmaeus300693 GTGATCTGACTCA-----TTCGTCACTACCACTGAGACAACATTGAG- R_norvegicus300670 GAAATTTAGC---AATT-TGC--CACTATCACTGAGACAGGGGAGTC- R_norvegicus300850 GTGATTTAAC--AAAAA-TTCGTCACTACCACTGAGACAACAATGAA- R_norvegicus300851 GTGATCTAACCCA-----TTCGTCACTACCACTGAGACAACATTGAG- S_araneus300900 GTGATCGACTGC-ATAA-TTCGTCACTACCACTGAGACAACAATGAA- S_araneus300901 GTGATCTAACTCAAA---TTCGTCACTACCACTGAGACAGCATTGAG- S_tridecemlineatus300248 GTGATCTAACTCAAA---TTCGTCACTACCACTGAGACAACATTGAG- T_nigroviridis300023 GTGGATTTATTTCAGCA-TTCGTCACTACCACTGAGGCA--------- T_nigroviridis300024 G-CAGTTCAC---A-TTTCTCGTCACTACCACTGAGACCACA-TCACG T_belangeri300374 GTGATCTAACTCAAATA-TTCGTCACTACCACTGAGACAACAATGAA- T_belangeri300375 ATGATCTAATTCAAA---CTCGTCACTACCACTGAGACAACATTGAG- X_tropicalis300116 G--ATTTCATTCAACAA-TTCGTCACTACCACTGAGGCAATACTTAA- * * * *****

Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved