snOPY snoRNA Orthological Gene Database
Mus_musculus SNORD21
sequence
GCCAATGATGACACCACACTAACTGAGCAGTTAGTAGTTGGTCCTTTGATTGCATGTGA
TGTAATCATTGTTTCAAGACGGGACTGAAGGCGGC
  Box motif
  Complementary to target RNA
length 94
organism Mus_musculus
snoRNA name SNORD21
alias
chromosome ⁄ contig 5
locus ⁄ host gene Rpl5
organization Intronic
target RNA 28S rRNA
modification type C/D
modification site 28S:G1130
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved