snOPY snoRNA Orthological Gene Database

Family: SNORD21

CLUSTAL 2.0.10 multiple sequence alignment C_elegans300081 ---------------------------AAAAAGTCAATGATGTTTTTTCA C_familiaris300031 ACTGAATGAC---ATCCCAC-CAATTGAGCA-GTCAGTAGTTGGT---TT C_familiaris300393 GCTGAATGATGATATCCCAC-TAACTGAGCA-GTCAGTAGTTGGTCCTTT C_porcellus300321 ATTGAATGATGATACCCTAC-TAACTTGGCA-GTCAGTAATTGGTCCTTT C_porcellus300945 GCCAAATGATGATAGTCTAC-AAACTGAGCA-GTCAGTAGTTGGTCCTTT D_rerio300117 TCTTGATGATGACAC-------CACTTGAAA-CTGAACAGCTGCTATTTC D_rerio300215 GCTTGATGATGATACCCTTTCAGACTGAGCA-AATTGTAGTTGGTCCTAC D_melanogaster300114 -------------------------ATATGATGTTAACAGCTTGTAATGA E_telfairi300768 GCTGGATGATGATATCCCTC-TAACTGAGCAAGTCGGTAGTTGGTCCTTC E_caballus300317 GCTGAATGATGATATCCCAC-TCACTGAGCA-GTCAGTAGTTGGTCCTTT E_europaeus300644 GCCGAGTGATGATATCCCAC-TAACTGAGCA-TTCAGTAGTTGGTCCTTT E_europaeus300645 GCCGAGTGATGATATCCCAC-TAACTGAGCA-TTCAGTAGTTGGTCCTTT G_gallus300100 GCTATGTGATGATACCCCAA-TGTCTGACCA-CTCCGTAGTAGGTCCATG H_sapiens300669 GCTGAATGATGATATCCCAC-TAACTGAGCA-GTCAGTAGTTGGTCCTTT L_africana300479 GCTAAATGATGATATCCCAC-TAACTGAGCAGTCCAGTAGTTGGTCCTTT M_mulatta300019 ---TAACGGTGAACTCAAAA--AACTTTCCAATCCTTCAGTAGCTGATCC M_mulatta300585 GCTGAATGATGATATCCCAC-TAACTGAGCA-GTCAGTAGTTGGTCCTTT M_murinus300472 GCCAAATGATGATACCCTAC-TAACTGAGCA-GTCAGTAGTTGGTCCTTT M_domestica300078 GCTGAATGATGATATCCCAC-TCACTGAG--------------------- M_musculus300771 -GCCAATGATGACACCACAC-TAACTGAGCA-GTTAGTAGTTGGTCCTTT O_anatinus304276 GCCGGATGATGATCTCCCA--CGACTGAGCA-TTCTGTAGTTGGTCCTTG O_cuniculus300403 GCTGAATGATGATATCCCAC-TCACTGAGCA-GTCAGTAGTTGGTCCTTT O_garnettii300620 GCCGAATGATGACACCC-AC-TAACTGAGCA-GTCAGTAGTTGGTCCTTC P_troglodytes300529 GCTGAATGATGATATCCCAC-TAACTGAGCA-GTCAGTAGTTGGTCCTTT P_pygmaeus300589 GCTGAATGATGATATCCCAC-TAACTGAGCA-GTCAGTAGTTGGTCCTTT R_norvegicus301006 -GCTAATGATGATACCGCAC-TAACTGAGCA-GTTAGTAGTTGGTCCTTT S_araneus300195 GCTAAATGATGATTTCCCAC-TAACTGAGCAAGTCAGTAGTTGGTCCTTT S_tridecemlineatus300305 GCTGAATGATGATATCCCAC-TAACTGAGCA-GTCAGTAGTTGGTCCTTT T_nigroviridis300103 TCTTGATGATGATACAAAGA-ACGCTGAGCA-AAATGTAGTTGGTCCTTC T_belangeri300409 GCCGAATGATGATACCCCAC-TAACTGAGCA-GTCGCTAGTTGGTCCTTT C_elegans300081 AGACGGGAC-CGACTGGTGAATGATGCATAAATGAAATGCTGAGACTTTT C_familiaris300031 GGTTGCATA-----TGA-TGCGGTTAAATTGATCCAA-GATGGGACTGAT C_familiaris300393 GGTTGCATA-----TGA-TGCAGTTAAT-TGTTTCAA-GACGGGACTGAT C_porcellus300321 GGTTGCATA-----TGA-TGTAGTAATTGTTACAAAA-GATGAGAGGGAT C_porcellus300945 GATTGCATA-----TGA-TATAATAATT--GTTTCAA-GACGGGACTGAT D_rerio300117 AGTTGTTCC--A-CTGA-TGTGA-------TTTTCAA-GACGGGACTGAT D_rerio300215 ATTTGCAC---AGTTGA-TGCAAGCA---TATTTCAA-GACGGGGCTGAG D_melanogaster300114 TTATGCATTGTGATTATTCAAGTTTATTTTGTTTCAA-GACGGGACTGAC E_telfairi300768 GGTTGCATG-----TGA-TGCAATTGCT-TGTTTCAA-GACGGGACTGAT E_caballus300317 GGTTGCATA-----TGA-T-CAATTAAT-TGTTTCAA-GACGGGACTGAT E_europaeus300644 GGTTGCATT--A--TGA-TGCAATTCAT-TGTTTCAA-GACGGGACTGAT E_europaeus300645 GGTTGCATT--A--TGA-TGCAATTCAT-TGTTTCAA-GACGGGACTGAT G_gallus300100 GTGTGTAAA-----TGA-TG-GACTGCGTAGTTTCAA-GACGGGACTGAT H_sapiens300669 GGTTGCATA-----TGA-TGCGAT-AAT-TGTTTCAA-GACGGGACTGAT L_africana300479 GGTTGCATA-----TGA-TGCAATTAAT-TGTTTCAA-GACGGGACTGAT M_mulatta300019 AGTCATTTG--AAGTGGCTGTGAAT----TATTTCAA-GAAGGGACTGAT M_mulatta300585 GGTTGCATA-----TGA-TGCGAT-AAT-TGTTTCAA-GACGGGACTGAT M_murinus300472 GGTTGCATA-----TGA-TGCAGTAATTGT--TTCAA-GACGGGACTGAT M_domestica300078 --TTGCTTA-----TGA-TGCAA----T-TGTTTCAA-GACGGGACTGAT M_musculus300771 GATTGCATG-----TGA-TGTAATCATT--GTTTCAA-GACGGGACTGAA O_anatinus304276 GTTTGCACA-----TGA-TGCAATTTCAGTGTTTCAA-GACGGGACTGAC O_cuniculus300403 GGTTGCATA-----TGA-TGCAACAG-T-TGTTTCAA-GACGGGACTGAT O_garnettii300620 GGT-GCATT-----TGA-TGCAATAATTGT--TCCAG-CGAGGGACTGAT P_troglodytes300529 GGTTGCATA-----TGA-TGCGAT-AAT-TGTTTCAA-GACGGGACTGAT P_pygmaeus300589 GGTTGCATA-----TGA-TGCGAT-AAT-TGTTTCAA-GACGGGACTGAT R_norvegicus301006 GATTGCATA-----TGA-TGTAATCATT--GTTTCAA-GACGGGACTGAT S_araneus300195 GATTGCATA--G--TGA-TGCAATTAAT-TGTTTCAA-GACGGGACTGAT S_tridecemlineatus300305 GGTTGCATA-----TGA-TGCAAT-AAT-TGTTTCAA-GACGGGACTGAT T_nigroviridis300103 ATTTGCATT--AGCTGA-TGTCTACTGT-CCTTTCAA-GACGGGGCTGAG T_belangeri300409 GGTTGCAT---A--TGA-TGTAATT-AT-TGTTTCAA-GACGGGACTGAT * * * * C_elegans300081 T--------- C_familiaris300031 ACCAGG---- C_familiaris300393 GGCAGC---- C_porcellus300321 AGGAAA---- C_porcellus300945 GGCAGC---- D_rerio300117 TGCAAGACAT D_rerio300215 AGCAGT---- D_melanogaster300114 TATA------ E_telfairi300768 GGCAGC---- E_caballus300317 GGCAGC---- E_europaeus300644 GGCAGC---- E_europaeus300645 GGCAGC---- G_gallus300100 GGCAGC---- H_sapiens300669 GGCAGC---- L_africana300479 GGCAGC---- M_mulatta300019 GGTGTGT--- M_mulatta300585 GGCAGC---- M_murinus300472 GGCAGC---- M_domestica300078 GGCAGG---- M_musculus300771 GGCGGC---- O_anatinus304276 GGCAGC---- O_cuniculus300403 GGCAGC---- O_garnettii300620 GCCGCG---- P_troglodytes300529 GGCAGC---- P_pygmaeus300589 GGCAGC---- R_norvegicus301006 GGCAGC---- S_araneus300195 GGCAGC---- S_tridecemlineatus300305 GGCAGC---- T_nigroviridis300103 AGAAGT---- T_belangeri300409 GGCAGC----

Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved